ID: 907806283

View in Genome Browser
Species Human (GRCh38)
Location 1:57823653-57823675
Sequence TCTACCCAACAATTGGGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806283_907806291 27 Left 907806283 1:57823653-57823675 CCTCATCCCAATTGTTGGGTAGA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 907806291 1:57823703-57823725 GGAAAGTGGCCCTGACATGAAGG 0: 1
1: 0
2: 1
3: 16
4: 193
907806283_907806288 6 Left 907806283 1:57823653-57823675 CCTCATCCCAATTGTTGGGTAGA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 907806288 1:57823682-57823704 GCCAGGGATTGATGTATAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 154
907806283_907806292 28 Left 907806283 1:57823653-57823675 CCTCATCCCAATTGTTGGGTAGA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 907806292 1:57823704-57823726 GAAAGTGGCCCTGACATGAAGGG No data
907806283_907806290 13 Left 907806283 1:57823653-57823675 CCTCATCCCAATTGTTGGGTAGA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 907806290 1:57823689-57823711 ATTGATGTATAAAAGGAAAGTGG No data
907806283_907806287 -10 Left 907806283 1:57823653-57823675 CCTCATCCCAATTGTTGGGTAGA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 907806287 1:57823666-57823688 GTTGGGTAGATGACTTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907806283 Original CRISPR TCTACCCAACAATTGGGATG AGG (reversed) Intronic