ID: 907806285

View in Genome Browser
Species Human (GRCh38)
Location 1:57823660-57823682
Sequence CAAGTCATCTACCCAACAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806285_907806293 24 Left 907806285 1:57823660-57823682 CCAATTGTTGGGTAGATGACTTG No data
Right 907806293 1:57823707-57823729 AGTGGCCCTGACATGAAGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 148
907806285_907806294 25 Left 907806285 1:57823660-57823682 CCAATTGTTGGGTAGATGACTTG No data
Right 907806294 1:57823708-57823730 GTGGCCCTGACATGAAGGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 187
907806285_907806292 21 Left 907806285 1:57823660-57823682 CCAATTGTTGGGTAGATGACTTG No data
Right 907806292 1:57823704-57823726 GAAAGTGGCCCTGACATGAAGGG No data
907806285_907806288 -1 Left 907806285 1:57823660-57823682 CCAATTGTTGGGTAGATGACTTG No data
Right 907806288 1:57823682-57823704 GCCAGGGATTGATGTATAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 154
907806285_907806290 6 Left 907806285 1:57823660-57823682 CCAATTGTTGGGTAGATGACTTG No data
Right 907806290 1:57823689-57823711 ATTGATGTATAAAAGGAAAGTGG No data
907806285_907806291 20 Left 907806285 1:57823660-57823682 CCAATTGTTGGGTAGATGACTTG No data
Right 907806291 1:57823703-57823725 GGAAAGTGGCCCTGACATGAAGG 0: 1
1: 0
2: 1
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907806285 Original CRISPR CAAGTCATCTACCCAACAAT TGG (reversed) Intronic