ID: 907806288

View in Genome Browser
Species Human (GRCh38)
Location 1:57823682-57823704
Sequence GCCAGGGATTGATGTATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806285_907806288 -1 Left 907806285 1:57823660-57823682 CCAATTGTTGGGTAGATGACTTG No data
Right 907806288 1:57823682-57823704 GCCAGGGATTGATGTATAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 154
907806284_907806288 0 Left 907806284 1:57823659-57823681 CCCAATTGTTGGGTAGATGACTT 0: 1
1: 0
2: 0
3: 6
4: 103
Right 907806288 1:57823682-57823704 GCCAGGGATTGATGTATAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 154
907806283_907806288 6 Left 907806283 1:57823653-57823675 CCTCATCCCAATTGTTGGGTAGA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 907806288 1:57823682-57823704 GCCAGGGATTGATGTATAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907806288 Original CRISPR GCCAGGGATTGATGTATAAA AGG Intronic