ID: 907806289

View in Genome Browser
Species Human (GRCh38)
Location 1:57823683-57823705
Sequence TCCTTTTATACATCAATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 132}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806289_907806297 18 Left 907806289 1:57823683-57823705 CCAGGGATTGATGTATAAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 907806297 1:57823724-57823746 GGGAGGGTAACTGCCATTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 115
907806289_907806293 1 Left 907806289 1:57823683-57823705 CCAGGGATTGATGTATAAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 907806293 1:57823707-57823729 AGTGGCCCTGACATGAAGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 148
907806289_907806294 2 Left 907806289 1:57823683-57823705 CCAGGGATTGATGTATAAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 907806294 1:57823708-57823730 GTGGCCCTGACATGAAGGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 187
907806289_907806298 19 Left 907806289 1:57823683-57823705 CCAGGGATTGATGTATAAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 907806298 1:57823725-57823747 GGAGGGTAACTGCCATTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 115
907806289_907806299 20 Left 907806289 1:57823683-57823705 CCAGGGATTGATGTATAAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 907806299 1:57823726-57823748 GAGGGTAACTGCCATTTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 162
907806289_907806291 -3 Left 907806289 1:57823683-57823705 CCAGGGATTGATGTATAAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 907806291 1:57823703-57823725 GGAAAGTGGCCCTGACATGAAGG 0: 1
1: 0
2: 1
3: 16
4: 193
907806289_907806292 -2 Left 907806289 1:57823683-57823705 CCAGGGATTGATGTATAAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 907806292 1:57823704-57823726 GAAAGTGGCCCTGACATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907806289 Original CRISPR TCCTTTTATACATCAATCCC TGG (reversed) Intronic