ID: 907806291 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:57823703-57823725 |
Sequence | GGAAAGTGGCCCTGACATGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 211 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 16, 4: 193} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
907806284_907806291 | 21 | Left | 907806284 | 1:57823659-57823681 | CCCAATTGTTGGGTAGATGACTT | 0: 1 1: 0 2: 0 3: 6 4: 103 |
||
Right | 907806291 | 1:57823703-57823725 | GGAAAGTGGCCCTGACATGAAGG | 0: 1 1: 0 2: 1 3: 16 4: 193 |
||||
907806289_907806291 | -3 | Left | 907806289 | 1:57823683-57823705 | CCAGGGATTGATGTATAAAAGGA | 0: 1 1: 0 2: 1 3: 13 4: 132 |
||
Right | 907806291 | 1:57823703-57823725 | GGAAAGTGGCCCTGACATGAAGG | 0: 1 1: 0 2: 1 3: 16 4: 193 |
||||
907806283_907806291 | 27 | Left | 907806283 | 1:57823653-57823675 | CCTCATCCCAATTGTTGGGTAGA | 0: 1 1: 0 2: 0 3: 10 4: 97 |
||
Right | 907806291 | 1:57823703-57823725 | GGAAAGTGGCCCTGACATGAAGG | 0: 1 1: 0 2: 1 3: 16 4: 193 |
||||
907806285_907806291 | 20 | Left | 907806285 | 1:57823660-57823682 | CCAATTGTTGGGTAGATGACTTG | No data | ||
Right | 907806291 | 1:57823703-57823725 | GGAAAGTGGCCCTGACATGAAGG | 0: 1 1: 0 2: 1 3: 16 4: 193 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
907806291 | Original CRISPR | GGAAAGTGGCCCTGACATGA AGG | Intronic | ||