ID: 907806291

View in Genome Browser
Species Human (GRCh38)
Location 1:57823703-57823725
Sequence GGAAAGTGGCCCTGACATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806283_907806291 27 Left 907806283 1:57823653-57823675 CCTCATCCCAATTGTTGGGTAGA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 907806291 1:57823703-57823725 GGAAAGTGGCCCTGACATGAAGG 0: 1
1: 0
2: 1
3: 16
4: 193
907806284_907806291 21 Left 907806284 1:57823659-57823681 CCCAATTGTTGGGTAGATGACTT 0: 1
1: 0
2: 0
3: 6
4: 103
Right 907806291 1:57823703-57823725 GGAAAGTGGCCCTGACATGAAGG 0: 1
1: 0
2: 1
3: 16
4: 193
907806285_907806291 20 Left 907806285 1:57823660-57823682 CCAATTGTTGGGTAGATGACTTG No data
Right 907806291 1:57823703-57823725 GGAAAGTGGCCCTGACATGAAGG 0: 1
1: 0
2: 1
3: 16
4: 193
907806289_907806291 -3 Left 907806289 1:57823683-57823705 CCAGGGATTGATGTATAAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 907806291 1:57823703-57823725 GGAAAGTGGCCCTGACATGAAGG 0: 1
1: 0
2: 1
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907806291 Original CRISPR GGAAAGTGGCCCTGACATGA AGG Intronic