ID: 907806292

View in Genome Browser
Species Human (GRCh38)
Location 1:57823704-57823726
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806289_907806292 -2 Left 907806289 1:57823683-57823705 CCAGGGATTGATGTATAAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 907806292 1:57823704-57823726 GAAAGTGGCCCTGACATGAAGGG No data
907806284_907806292 22 Left 907806284 1:57823659-57823681 CCCAATTGTTGGGTAGATGACTT 0: 1
1: 0
2: 0
3: 6
4: 103
Right 907806292 1:57823704-57823726 GAAAGTGGCCCTGACATGAAGGG No data
907806285_907806292 21 Left 907806285 1:57823660-57823682 CCAATTGTTGGGTAGATGACTTG No data
Right 907806292 1:57823704-57823726 GAAAGTGGCCCTGACATGAAGGG No data
907806283_907806292 28 Left 907806283 1:57823653-57823675 CCTCATCCCAATTGTTGGGTAGA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 907806292 1:57823704-57823726 GAAAGTGGCCCTGACATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type