ID: 907806293 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:57823707-57823729 |
Sequence | AGTGGCCCTGACATGAAGGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 164 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 15, 4: 148} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
907806284_907806293 | 25 | Left | 907806284 | 1:57823659-57823681 | CCCAATTGTTGGGTAGATGACTT | 0: 1 1: 0 2: 0 3: 6 4: 103 |
||
Right | 907806293 | 1:57823707-57823729 | AGTGGCCCTGACATGAAGGGAGG | 0: 1 1: 0 2: 0 3: 15 4: 148 |
||||
907806289_907806293 | 1 | Left | 907806289 | 1:57823683-57823705 | CCAGGGATTGATGTATAAAAGGA | 0: 1 1: 0 2: 1 3: 13 4: 132 |
||
Right | 907806293 | 1:57823707-57823729 | AGTGGCCCTGACATGAAGGGAGG | 0: 1 1: 0 2: 0 3: 15 4: 148 |
||||
907806285_907806293 | 24 | Left | 907806285 | 1:57823660-57823682 | CCAATTGTTGGGTAGATGACTTG | No data | ||
Right | 907806293 | 1:57823707-57823729 | AGTGGCCCTGACATGAAGGGAGG | 0: 1 1: 0 2: 0 3: 15 4: 148 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
907806293 | Original CRISPR | AGTGGCCCTGACATGAAGGG AGG | Intronic | ||