ID: 907806293

View in Genome Browser
Species Human (GRCh38)
Location 1:57823707-57823729
Sequence AGTGGCCCTGACATGAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806284_907806293 25 Left 907806284 1:57823659-57823681 CCCAATTGTTGGGTAGATGACTT 0: 1
1: 0
2: 0
3: 6
4: 103
Right 907806293 1:57823707-57823729 AGTGGCCCTGACATGAAGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 148
907806289_907806293 1 Left 907806289 1:57823683-57823705 CCAGGGATTGATGTATAAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 907806293 1:57823707-57823729 AGTGGCCCTGACATGAAGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 148
907806285_907806293 24 Left 907806285 1:57823660-57823682 CCAATTGTTGGGTAGATGACTTG No data
Right 907806293 1:57823707-57823729 AGTGGCCCTGACATGAAGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907806293 Original CRISPR AGTGGCCCTGACATGAAGGG AGG Intronic