ID: 907806294

View in Genome Browser
Species Human (GRCh38)
Location 1:57823708-57823730
Sequence GTGGCCCTGACATGAAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806285_907806294 25 Left 907806285 1:57823660-57823682 CCAATTGTTGGGTAGATGACTTG No data
Right 907806294 1:57823708-57823730 GTGGCCCTGACATGAAGGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 187
907806284_907806294 26 Left 907806284 1:57823659-57823681 CCCAATTGTTGGGTAGATGACTT 0: 1
1: 0
2: 0
3: 6
4: 103
Right 907806294 1:57823708-57823730 GTGGCCCTGACATGAAGGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 187
907806289_907806294 2 Left 907806289 1:57823683-57823705 CCAGGGATTGATGTATAAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 907806294 1:57823708-57823730 GTGGCCCTGACATGAAGGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907806294 Original CRISPR GTGGCCCTGACATGAAGGGA GGG Intronic