ID: 907806295

View in Genome Browser
Species Human (GRCh38)
Location 1:57823712-57823734
Sequence GTTACCCTCCCTTCATGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806295_907806301 5 Left 907806295 1:57823712-57823734 CCCTGACATGAAGGGAGGGTAAC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 907806301 1:57823740-57823762 TTTTTGGGGCCCCCATTCTCTGG 0: 1
1: 0
2: 1
3: 16
4: 122
907806295_907806298 -10 Left 907806295 1:57823712-57823734 CCCTGACATGAAGGGAGGGTAAC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 907806298 1:57823725-57823747 GGAGGGTAACTGCCATTTTTGGG 0: 1
1: 0
2: 0
3: 8
4: 115
907806295_907806307 18 Left 907806295 1:57823712-57823734 CCCTGACATGAAGGGAGGGTAAC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 907806307 1:57823753-57823775 CATTCTCTGGGAACCGCATGAGG 0: 1
1: 0
2: 1
3: 24
4: 1884
907806295_907806302 6 Left 907806295 1:57823712-57823734 CCCTGACATGAAGGGAGGGTAAC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 907806302 1:57823741-57823763 TTTTGGGGCCCCCATTCTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 128
907806295_907806299 -9 Left 907806295 1:57823712-57823734 CCCTGACATGAAGGGAGGGTAAC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 907806299 1:57823726-57823748 GAGGGTAACTGCCATTTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907806295 Original CRISPR GTTACCCTCCCTTCATGTCA GGG (reversed) Intronic