ID: 907806296

View in Genome Browser
Species Human (GRCh38)
Location 1:57823713-57823735
Sequence AGTTACCCTCCCTTCATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806296_907806301 4 Left 907806296 1:57823713-57823735 CCTGACATGAAGGGAGGGTAACT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 907806301 1:57823740-57823762 TTTTTGGGGCCCCCATTCTCTGG 0: 1
1: 0
2: 1
3: 16
4: 122
907806296_907806307 17 Left 907806296 1:57823713-57823735 CCTGACATGAAGGGAGGGTAACT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 907806307 1:57823753-57823775 CATTCTCTGGGAACCGCATGAGG 0: 1
1: 0
2: 1
3: 24
4: 1884
907806296_907806299 -10 Left 907806296 1:57823713-57823735 CCTGACATGAAGGGAGGGTAACT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 907806299 1:57823726-57823748 GAGGGTAACTGCCATTTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 162
907806296_907806302 5 Left 907806296 1:57823713-57823735 CCTGACATGAAGGGAGGGTAACT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 907806302 1:57823741-57823763 TTTTGGGGCCCCCATTCTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907806296 Original CRISPR AGTTACCCTCCCTTCATGTC AGG (reversed) Intronic