ID: 907806297

View in Genome Browser
Species Human (GRCh38)
Location 1:57823724-57823746
Sequence GGGAGGGTAACTGCCATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806289_907806297 18 Left 907806289 1:57823683-57823705 CCAGGGATTGATGTATAAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 907806297 1:57823724-57823746 GGGAGGGTAACTGCCATTTTTGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907806297 Original CRISPR GGGAGGGTAACTGCCATTTT TGG Intronic