ID: 907806299

View in Genome Browser
Species Human (GRCh38)
Location 1:57823726-57823748
Sequence GAGGGTAACTGCCATTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806296_907806299 -10 Left 907806296 1:57823713-57823735 CCTGACATGAAGGGAGGGTAACT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 907806299 1:57823726-57823748 GAGGGTAACTGCCATTTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 162
907806289_907806299 20 Left 907806289 1:57823683-57823705 CCAGGGATTGATGTATAAAAGGA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 907806299 1:57823726-57823748 GAGGGTAACTGCCATTTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 162
907806295_907806299 -9 Left 907806295 1:57823712-57823734 CCCTGACATGAAGGGAGGGTAAC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 907806299 1:57823726-57823748 GAGGGTAACTGCCATTTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907806299 Original CRISPR GAGGGTAACTGCCATTTTTG GGG Intronic