ID: 907806301

View in Genome Browser
Species Human (GRCh38)
Location 1:57823740-57823762
Sequence TTTTTGGGGCCCCCATTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806295_907806301 5 Left 907806295 1:57823712-57823734 CCCTGACATGAAGGGAGGGTAAC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 907806301 1:57823740-57823762 TTTTTGGGGCCCCCATTCTCTGG 0: 1
1: 0
2: 1
3: 16
4: 122
907806296_907806301 4 Left 907806296 1:57823713-57823735 CCTGACATGAAGGGAGGGTAACT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 907806301 1:57823740-57823762 TTTTTGGGGCCCCCATTCTCTGG 0: 1
1: 0
2: 1
3: 16
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907806301 Original CRISPR TTTTTGGGGCCCCCATTCTC TGG Intronic