ID: 907806808

View in Genome Browser
Species Human (GRCh38)
Location 1:57828424-57828446
Sequence GTCCCCAAGATTACTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907806808_907806811 15 Left 907806808 1:57828424-57828446 CCTGCTGCAGTAATCTTGGGGAC No data
Right 907806811 1:57828462-57828484 ATTGTTTTTTCTTTGTGTTCTGG 0: 1
1: 0
2: 8
3: 106
4: 1396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907806808 Original CRISPR GTCCCCAAGATTACTGCAGC AGG (reversed) Intronic
No off target data available for this crispr