ID: 907811159

View in Genome Browser
Species Human (GRCh38)
Location 1:57871449-57871471
Sequence ACAGCTAGTAAGCTTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907811156_907811159 6 Left 907811156 1:57871420-57871442 CCCAGAGAAATTATCTTTCCGAA 0: 1
1: 0
2: 3
3: 39
4: 271
Right 907811159 1:57871449-57871471 ACAGCTAGTAAGCTTAGAGCTGG 0: 1
1: 0
2: 5
3: 18
4: 133
907811157_907811159 5 Left 907811157 1:57871421-57871443 CCAGAGAAATTATCTTTCCGAAG 0: 1
1: 0
2: 4
3: 41
4: 295
Right 907811159 1:57871449-57871471 ACAGCTAGTAAGCTTAGAGCTGG 0: 1
1: 0
2: 5
3: 18
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907811159 Original CRISPR ACAGCTAGTAAGCTTAGAGC TGG Intronic
903993737 1:27291787-27291809 ACTGCTAGTAAGTGCAGAGCTGG - Intronic
904017543 1:27434386-27434408 ACATCTAGAAATTTTAGAGCTGG - Intronic
904271690 1:29354400-29354422 ACAGGTAGAAAGGTTAGTGCTGG + Intergenic
905211627 1:36378309-36378331 ACAGCCAGTAAGGGCAGAGCTGG - Intronic
905646947 1:39631758-39631780 ACAGCAAGAAAGCGCAGAGCTGG + Intronic
906289130 1:44608482-44608504 ACAGCTACAAAGTTCAGAGCAGG - Intronic
907799964 1:57754774-57754796 ACAGCTAGTGAGAGCAGAGCTGG + Intronic
907811159 1:57871449-57871471 ACAGCTAGTAAGCTTAGAGCTGG + Intronic
910570329 1:88694240-88694262 ACAGAGAATAAGCTTAGTGCAGG - Intronic
915232842 1:154458603-154458625 ACAGCTAGTAAGAATAGGCCAGG + Intronic
917449086 1:175131819-175131841 ACAACTAGTAAGTATAGAACTGG + Intronic
917736406 1:177924855-177924877 ACAGCTAGTAAGGATGGAGCTGG - Intronic
919878073 1:201885121-201885143 ACAGCAAGAAAGATTAAAGCTGG + Intergenic
920196356 1:204229861-204229883 ACAGCTATTAAGTACAGAGCTGG - Intronic
920249073 1:204610426-204610448 ACGACTAATAAGGTTAGAGCTGG - Intergenic
922041171 1:221900254-221900276 ACAGCTAGTAAGCAAAGTGGGGG - Intergenic
923044875 1:230348409-230348431 ACAGCTGGTCAGCACAGAGCTGG - Intronic
1063391333 10:5651629-5651651 ACACCTAGTAAGCACAGAGCAGG + Intronic
1067899815 10:50227941-50227963 ACAGAAAGTAAAGTTAGAGCAGG + Intronic
1074287387 10:112110837-112110859 ACAGGTAGTTAGGTGAGAGCAGG - Intergenic
1078179395 11:8998177-8998199 TCAGCTAGTAAGCAAAGAGAAGG - Intronic
1080083119 11:28245181-28245203 ACAGTGAGTAAGGGTAGAGCTGG - Intronic
1081371202 11:42305629-42305651 ACAACAAGTAATCTTAGACCAGG - Intergenic
1084907870 11:72362570-72362592 ACAGTCAGTAAGTTCAGAGCTGG - Intronic
1085650342 11:78262256-78262278 ACAACTAGTAAGCTGAGATTCGG - Intronic
1087677335 11:101178279-101178301 ACAGCTGGTAAGATGAGAGCTGG - Intergenic
1091501952 12:1026659-1026681 ACAGTAAGTAAGCTCAGATCAGG + Intronic
1093543069 12:20310645-20310667 AAAGCTAGCAAGGTTAGAGAGGG + Intergenic
1096483498 12:51959484-51959506 ACAACCAGTAAGCTTGGAGGAGG + Intronic
1098641913 12:72849090-72849112 GTAACTAGTAAGCATAGAGCTGG + Intergenic
1100458300 12:94774201-94774223 AGAGCTAGTAATCTAAGAGAGGG + Intergenic
1100545172 12:95595056-95595078 ACATCTAGTAAGTGCAGAGCAGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1101806148 12:108065561-108065583 ACAGCTAGAAAGAGCAGAGCTGG - Intergenic
1102619723 12:114184339-114184361 ACAGCTAGTCAGGGCAGAGCTGG - Intergenic
1102919483 12:116781124-116781146 ACAGCTAGTCAGTGCAGAGCTGG - Intronic
1107250484 13:38354031-38354053 ACAGCAAATAGCCTTAGAGCTGG - Intronic
1109036466 13:57268151-57268173 ACAGGTAGTAAGCATAGTACCGG + Intergenic
1109062819 13:57640592-57640614 AGAGCTAGTGACCCTAGAGCGGG + Intronic
1115885774 14:37970161-37970183 AGAGCTAGTAAGATTAGAGAAGG - Intronic
1119206024 14:72794098-72794120 ACAGCAAGTAAGCAAGGAGCTGG - Intronic
1121080612 14:91104812-91104834 ACAGCAGGGAAGCTGAGAGCTGG - Intronic
1125371957 15:38987283-38987305 ACAGCCTGAAGGCTTAGAGCAGG - Intergenic
1128372665 15:67051878-67051900 ACAGCTTGCAAGCTGGGAGCAGG + Intergenic
1128536844 15:68498071-68498093 ACAGCTAGAAAGGGCAGAGCTGG + Intergenic
1130006876 15:80107993-80108015 ACAGCTAGTAAGTGAGGAGCTGG - Intronic
1130029686 15:80300728-80300750 TCAGGTAGTAAGCATAGTGCTGG + Intergenic
1131433257 15:92403220-92403242 ACAGCTAGTAAACATGGAGCTGG + Intronic
1133614856 16:7466607-7466629 ACAGCTAGTGAGTGCAGAGCTGG - Intronic
1133630649 16:7617142-7617164 ACAGCTTGTTAGCTTAAAGCAGG + Intronic
1134782970 16:16915641-16915663 ACAGCTGGTAAGAGCAGAGCCGG + Intergenic
1138581676 16:57945684-57945706 CCTGCCAGTAAGCGTAGAGCTGG - Intronic
1140441785 16:74993461-74993483 GCAGCTAGTAAGAGCAGAGCTGG - Intronic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1144623647 17:16833553-16833575 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1144794921 17:17884618-17884640 ACAGCGGGTAAGCTTCCAGCTGG - Exonic
1144882782 17:18439163-18439185 ACAGCTGGTAAGGGCAGAGCAGG + Intergenic
1144957549 17:19026752-19026774 ACAGCAAGAAAGGTCAGAGCTGG + Intronic
1144977607 17:19147764-19147786 ACAGCAAGAAAGGTCAGAGCTGG - Intronic
1145149449 17:20505223-20505245 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1145781763 17:27568250-27568272 ACAGCAAGTGAGCCCAGAGCTGG - Intronic
1146304825 17:31722861-31722883 GCAGCTAGGCAGCTGAGAGCTGG - Intergenic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1148336286 17:46843634-46843656 CCAGCTAGTAAGCTTAGAACCGG - Intronic
1149222554 17:54432146-54432168 AAAGCTAGAAAGCTCTGAGCAGG - Intergenic
1152879096 17:82805266-82805288 ACAGCAAGTAGGCGTAGAGCAGG + Intronic
1153338813 18:3953007-3953029 ACAACTAATAAACTTAGAGATGG - Intronic
1153824134 18:8859274-8859296 ACAGCATTTAAGATTAGAGCAGG + Intergenic
1155587541 18:27384753-27384775 ACAGCAAGTAAGGTCTGAGCAGG + Intergenic
1155874271 18:31065508-31065530 ACAGCTAGTAAGGATAGAGCCGG + Exonic
1156859401 18:41818526-41818548 ACAGCTAGAGAGTTTAAAGCAGG - Intergenic
1163092790 19:15032808-15032830 ACAGATAGATAGCTCAGAGCTGG - Intergenic
1163258762 19:16173831-16173853 ACAGCTAGTGGGCAGAGAGCTGG - Intergenic
927800209 2:26091868-26091890 ACAGCTAGTAAGATCAGATGAGG + Intronic
928612872 2:33007921-33007943 ACAGCTAGTCAGTGTTGAGCTGG + Intronic
928805811 2:35153047-35153069 ACACCTATTAAACTTAGAACTGG + Intergenic
931170358 2:59796915-59796937 ATAGCTACTCAGCCTAGAGCAGG - Intergenic
932692002 2:73921283-73921305 ACAGCTGGTAAGCAGAGTGCGGG + Intergenic
932850689 2:75181984-75182006 AGAGCTAGTCAGTTTAGAGCTGG + Intronic
937064268 2:119005481-119005503 ACAGCTAGGAAGGGCAGAGCTGG + Intergenic
937398658 2:121562154-121562176 ACAGCAAGTCTTCTTAGAGCTGG + Intronic
939287019 2:140144933-140144955 CCAGCTAAAAAGCTTAGAGCTGG - Intergenic
945108910 2:206344278-206344300 CCAGTTAGTAAGCCAAGAGCAGG - Intergenic
945197534 2:207251316-207251338 ACAGCTAGTAAGTGATGAGCCGG + Intergenic
946109699 2:217403758-217403780 AAAGCTAGTAAGTGCAGAGCTGG + Intronic
946202740 2:218080441-218080463 ACAGCTAGAAAGCTGTGAGGTGG - Intronic
947398831 2:229713538-229713560 ACTGCTCCTAAGCTTAGAGAGGG + Intronic
947433847 2:230055101-230055123 ACAGCCAGTAAGTGTAGAACTGG - Intronic
948473347 2:238200967-238200989 ACAGTTAGTAAGCGAAGAGCTGG + Intronic
1172900522 20:38331263-38331285 ACAGTTAGTAAGTATGGAGCAGG - Intronic
1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG + Intergenic
1173132854 20:40410932-40410954 ACAGCTAGTAAGGATAGAGCTGG - Intergenic
1178500387 21:33121343-33121365 CCAGCCAGTAAGTGTAGAGCTGG - Intergenic
1183355509 22:37356781-37356803 ACAGCTGGTAAGTCCAGAGCAGG + Intergenic
1183757002 22:39777020-39777042 ACAGCTACAAAGCAGAGAGCTGG + Intronic
1184634850 22:45819038-45819060 TAAGCTAGTAAGCTTACAACTGG - Intronic
1184877537 22:47285002-47285024 GCAGCTGGTGAGCTCAGAGCCGG - Intergenic
950116407 3:10452922-10452944 ACTGCCAGTAAGTTTAGTGCAGG - Intronic
950437527 3:12989521-12989543 AAAGCTAGGAAGCTGACAGCTGG + Intronic
951279972 3:20736192-20736214 ACAGGTAGTAAGCTAAAGGCTGG + Intergenic
959800024 3:110482403-110482425 GCACCTAGTCACCTTAGAGCAGG + Intergenic
961109005 3:124267960-124267982 ACAGTTAATAAGCATAGGGCTGG + Intronic
961511192 3:127404808-127404830 ACAGCTAGTGAGTATGGAGCAGG - Intergenic
961945266 3:130680283-130680305 ACAGCTAGTAAACAGAAAGCTGG - Intronic
962626032 3:137226968-137226990 AGAGCTAGAAAGCTGAGGGCAGG + Intergenic
963865297 3:150354374-150354396 ACAGATAACAAGCTTAGGGCAGG - Intergenic
964624802 3:158748780-158748802 ACAGCCAGGAAGGGTAGAGCTGG + Intronic
967460350 3:189739061-189739083 CCAGCTAGAAAGCCTTGAGCTGG - Intronic
969288474 4:6222932-6222954 ACAGCTAGTGAGAGAAGAGCTGG + Intergenic
971964600 4:33537012-33537034 ACATCTAGTTTGGTTAGAGCTGG + Intergenic
974362437 4:60899638-60899660 ACAGCAGGTAAGCTCAGAGAAGG - Intergenic
974733976 4:65904150-65904172 ACAACTAGTAAACATAGAACTGG - Intergenic
975831669 4:78375407-78375429 ACAGCTGGGAAGGTTAGAGGAGG + Intronic
976220117 4:82749979-82750001 ACAGCTAATAAACGTAGAGCTGG - Intronic
979623355 4:122820337-122820359 ACAGCAAATATCCTTAGAGCAGG + Intergenic
982127805 4:152199527-152199549 ACTGCTAGTAAGGGTGGAGCTGG - Intergenic
984191925 4:176616059-176616081 ACAGCTACTAAGCTAACAGCTGG - Intergenic
990155300 5:52870368-52870390 AAAGATAGAAAGCTAAGAGCTGG + Intronic
990685693 5:58298266-58298288 ACAGCAAGGAAGCTGGGAGCAGG - Intergenic
992793972 5:80239016-80239038 ACAGCTAGTCAGCTCACAGCAGG - Intronic
995070193 5:107912306-107912328 ATAGCTAGTAAGTCCAGAGCTGG + Intronic
997302683 5:132817929-132817951 ACAGCTAGTAAATGCAGAGCTGG + Intergenic
997616313 5:135248672-135248694 ACAGCTGGAAATCCTAGAGCTGG + Intronic
997710617 5:136001179-136001201 ACAGCAAGTAAGCAGAGAACTGG + Intergenic
999273214 5:150310334-150310356 ACAGCTAGGAAGGGTGGAGCTGG - Intronic
1000129491 5:158282280-158282302 ACAGCTAGTAAGTGTAGAAGTGG + Intergenic
1006717230 6:36128342-36128364 ACAGCTGGTAAGGGCAGAGCTGG - Intronic
1013602067 6:111714331-111714353 ACAGCTCGTAAGTTTGGAGAGGG - Exonic
1014946857 6:127509102-127509124 ACAGCAAGAAAGCATAGTGCTGG + Intronic
1015922433 6:138279381-138279403 ACAGCCAGTGAGCTTAGTTCTGG - Intronic
1016004980 6:139079980-139080002 ACACCTAGGAAGCTGAGAACAGG + Intergenic
1017088404 6:150736405-150736427 TCAGCTAGCAAACTTAGAGAAGG - Intronic
1017948120 6:159113144-159113166 ACAGCTAACAAGCGGAGAGCTGG + Intergenic
1018714926 6:166524832-166524854 ACAGCTCGTGGGGTTAGAGCTGG + Intronic
1022525110 7:31032142-31032164 ACAGGGAGTAAGCATAGAGTTGG + Intergenic
1023745243 7:43317109-43317131 ACAGCTAGTGGTCTTAGACCAGG + Intronic
1024255161 7:47535328-47535350 ACAGCTAGAAAACTTAAAGAGGG + Intronic
1027620225 7:80475314-80475336 AGAGTTAGGAAGCTGAGAGCAGG - Intronic
1030008274 7:105139856-105139878 ACAGTTATTAAGTTTTGAGCTGG + Intronic
1031203175 7:118717872-118717894 AGAGGAAGTAAGCTTTGAGCTGG + Intergenic
1034080960 7:148277344-148277366 ACAGCAAGTAAGCAAAGGGCAGG - Intronic
1034472537 7:151263127-151263149 AGAGCTAGTAGGGGTAGAGCTGG + Intronic
1039188708 8:34947250-34947272 ACAACTGGTAAAATTAGAGCTGG - Intergenic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1042864939 8:73348929-73348951 ACGGCTAGTAAGTTTGGAGCTGG + Intergenic
1042937158 8:74071089-74071111 ACAGCTAGCAAGCATAGGGCAGG + Intergenic
1043196852 8:77305051-77305073 ACAGCTAGTAAGGATAGAGCTGG + Intergenic
1044343613 8:91076631-91076653 ACAGCTGGTAAGAGCAGAGCAGG - Intronic
1046918349 8:119700929-119700951 ACACCTAGAAAGCAGAGAGCTGG + Intergenic
1051376436 9:16407314-16407336 ACAGAGAGAAAACTTAGAGCAGG + Intergenic
1056739286 9:89239479-89239501 TCAGCTAGTAAGTACAGAGCTGG - Intergenic
1185653287 X:1664881-1664903 ACAGCTATTAACATTAAAGCTGG + Intergenic
1188415158 X:29924004-29924026 ACAGCTAGTAAGAACAGAGTTGG - Intronic
1192089182 X:68134646-68134668 ATAGCAGGTAAGCTCAGAGCTGG + Intronic
1192232605 X:69276373-69276395 ACAGCTAGTAATGGCAGAGCTGG + Intergenic
1196997891 X:121403973-121403995 AAAGATAGTAAGATTAGAGGAGG + Intergenic
1198581097 X:138065437-138065459 ACAGCTAGTAAGAACAGAGCTGG + Intergenic