ID: 907812605

View in Genome Browser
Species Human (GRCh38)
Location 1:57886503-57886525
Sequence CAAATTCTTTACCACGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907812602_907812605 30 Left 907812602 1:57886450-57886472 CCGGCATATTCTGCTACTGTTAA 0: 1
1: 0
2: 1
3: 15
4: 185
Right 907812605 1:57886503-57886525 CAAATTCTTTACCACGTACCAGG 0: 1
1: 1
2: 0
3: 10
4: 90
907812603_907812605 -9 Left 907812603 1:57886489-57886511 CCACCAGCAGTTAACAAATTCTT 0: 1
1: 0
2: 1
3: 11
4: 196
Right 907812605 1:57886503-57886525 CAAATTCTTTACCACGTACCAGG 0: 1
1: 1
2: 0
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907812605 Original CRISPR CAAATTCTTTACCACGTACC AGG Intronic
903276255 1:22223778-22223800 CACATTCTTCAGCACGTTCCTGG - Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
907812605 1:57886503-57886525 CAAATTCTTTACCACGTACCAGG + Intronic
908346206 1:63236255-63236277 AAACTTCTTTACCACATATCTGG + Intergenic
915943090 1:160131167-160131189 CAAATTGTTTACTATGTATCAGG - Intronic
916915982 1:169407370-169407392 CAAATTCTATACCAAGTAAAAGG + Intronic
924902034 1:248411470-248411492 CGAATTCTTTACCACATAGCTGG - Intergenic
1064365423 10:14703171-14703193 CAAATTCATTAGCACGCACATGG - Intronic
1064577533 10:16761387-16761409 CAAGTTCCTTACCATGTACCAGG - Intronic
1068327566 10:55514454-55514476 CAAATTTATTAACATGTACCTGG + Intronic
1068550789 10:58405553-58405575 CACATTGTTTACCATTTACCTGG - Intergenic
1073603966 10:104874746-104874768 CATATTCTTTACCATATCCCTGG + Intronic
1073655307 10:105408265-105408287 CAACTTCTTCACCACGTAAATGG + Intergenic
1074262377 10:111866952-111866974 TAAATACCTTACCACGTACAAGG + Intergenic
1080959237 11:37138676-37138698 CAAATTCTTTACCAAGGTCAAGG - Intergenic
1082849331 11:57751968-57751990 CAAATTCTTTGCCTACTACCAGG - Intronic
1087994444 11:104786352-104786374 CACATTCTTTTCCAAGTAACAGG + Intergenic
1093644321 12:21566627-21566649 CTAAATCTTTACAATGTACCAGG + Intronic
1098070888 12:66673531-66673553 GAAATACTTTACCTCGTTCCAGG - Intronic
1102108557 12:110346311-110346333 CACACTCTTTACCAGGTTCCAGG - Exonic
1102229135 12:111250289-111250311 CAAATTCCTTACCACACAACTGG + Intronic
1104399944 12:128466941-128466963 CAAAGTCTTTATCAGGTACCAGG - Intronic
1111909345 13:94293170-94293192 CAAATACTCTACCAAGTACCAGG + Intronic
1118014581 14:61646035-61646057 CAAATTCAATGCCACGTACAAGG + Intronic
1123677575 15:22726258-22726280 CAAAGTGTTTACCATGTGCCAGG + Intergenic
1123818432 15:24002472-24002494 CAAATTCATAACCACATCCCTGG - Intergenic
1124329782 15:28800521-28800543 CAAAGTGTTTACCATGTGCCAGG + Intergenic
1128493310 15:68172611-68172633 CACATTATTTGCCAAGTACCAGG - Intronic
1128708581 15:69855425-69855447 CAACTTATTTGCCACGTAGCGGG + Intergenic
1129264268 15:74385633-74385655 CAAATTCCTTAGCACATGCCAGG + Intergenic
1132157791 15:99508828-99508850 CAAAATCTTTACCAGGGACAGGG - Intergenic
1133319741 16:4905671-4905693 CCAAGTCTTTACTTCGTACCAGG - Intronic
1134299664 16:12978451-12978473 CAAATTATTTACCATCTACATGG - Intronic
1140495031 16:75378541-75378563 TAAATTATTTGCCACGTACCAGG + Intronic
1140915773 16:79491943-79491965 CCACTTCTTTTCTACGTACCCGG + Intergenic
1145916519 17:28577118-28577140 CAATCCCTTTACCACGTGCCGGG + Exonic
1148260360 17:46177215-46177237 CAATTACTTGGCCACGTACCTGG + Intronic
1149541742 17:57472731-57472753 CATAGTGTTTACGACGTACCAGG - Intronic
1151017644 17:70575986-70576008 CTATTTCTCTACCATGTACCAGG + Intergenic
1153462477 18:5351976-5351998 CACATTCTTTACCACATATCTGG - Intergenic
1157811512 18:50700313-50700335 CAAATTCTTTATGATGTATCAGG + Intronic
1157846928 18:51012750-51012772 CGAATTCTTTACCACTTTTCTGG - Intronic
1162247421 19:9413589-9413611 TAAATGCTTTACCACATTCCAGG + Exonic
1166494693 19:43291009-43291031 TAAATGCTTTAGCACGTATCTGG - Intergenic
927316164 2:21685771-21685793 CAAATTTAATACCACGTTCCTGG - Intergenic
929106717 2:38372422-38372444 CAAATACTATACCATGTTCCAGG + Intronic
931000764 2:57779641-57779663 AAAATTCTTAACCACATAACAGG - Intergenic
931793481 2:65687226-65687248 CAATGTCTTAACCATGTACCTGG - Intergenic
941659115 2:168177260-168177282 CAAATGCTTTGCCTCGTCCCCGG + Intronic
942086377 2:172447851-172447873 CAAAGTCTTTACCACGTACCGGG - Intronic
944026132 2:195170339-195170361 AAAACACTTTACCATGTACCAGG + Intergenic
948047895 2:234957747-234957769 CAAATTCATCACCACATCCCTGG - Intronic
948294562 2:236850978-236851000 CTATTTGTCTACCACGTACCAGG + Intergenic
1169445564 20:5668481-5668503 GAAAGTCTTTACCAAGTACATGG - Intergenic
1171235261 20:23519323-23519345 CAAGTTCTTCGCCACGTTCCTGG - Intergenic
1172240648 20:33410425-33410447 TAAATCCTTTACCACCTAACAGG + Intronic
1173745841 20:45436488-45436510 CAAAATCTGTACCAGGTATCTGG - Intergenic
1177381860 21:20354573-20354595 CAAATTCTGTGCCAGGTAGCAGG + Intergenic
951986868 3:28630494-28630516 TAAATTCTTTGGCACTTACCTGG + Intergenic
952488188 3:33837380-33837402 CAAAGTGTTTACCATGTGCCAGG + Intronic
953109640 3:39921570-39921592 CAACATCTTTACAATGTACCTGG - Intronic
962574621 3:136745421-136745443 AAAATTTTTTTCCACGAACCTGG - Intronic
962651298 3:137495812-137495834 CAAAGCCTTTACCATGTACATGG - Intergenic
964079683 3:152738368-152738390 CCATTTGTTTACCACCTACCAGG - Intergenic
964466733 3:157000986-157001008 CACATTCTTTACAATGTAGCAGG - Intronic
970607474 4:17694185-17694207 CCAATCCTTTACTATGTACCTGG - Intronic
982566485 4:156993340-156993362 CAACTTCTTTCTCAAGTACCTGG - Intergenic
982710060 4:158749057-158749079 CACATCCTTTACCATTTACCAGG + Intergenic
988480414 5:31625681-31625703 CACAGTCTTTACCACATACTAGG + Intergenic
995308436 5:110682506-110682528 CATTTTCTTTACCACTTCCCAGG + Intronic
997782817 5:136676978-136677000 CAAGTTCCTTACCAGGGACCAGG + Intergenic
999663640 5:153891010-153891032 CAAATTGTTGAGCATGTACCAGG - Intergenic
1001099804 5:168804821-168804843 CAAAGTCTTTAAAACGTCCCAGG + Intronic
1001737758 5:174020723-174020745 CAAATTCTTTTCTAGGTACCAGG + Intergenic
1002959358 6:1899187-1899209 CTAATTATTTACCATGTGCCTGG - Intronic
1007411839 6:41668278-41668300 CAAATCCTTTACCACTTTCCTGG - Intergenic
1008749732 6:54717827-54717849 CAATTTCTTTACCTCTTTCCTGG - Intergenic
1008884447 6:56417131-56417153 CAAATTCTTTACCACTTAAGAGG + Intergenic
1008936141 6:56994658-56994680 GAAATGCTTTACCTAGTACCTGG + Intronic
1011337550 6:86277787-86277809 CAAATCTTCTACCACTTACCAGG + Intergenic
1012973837 6:105758615-105758637 CAGATTCTGTATCACATACCAGG - Intergenic
1022560726 7:31346356-31346378 GAAATGCTTTACCACGACCCAGG - Intergenic
1024118890 7:46217595-46217617 CTAATTCTTTTCCACGAATCAGG - Intergenic
1028368277 7:90060664-90060686 CAAGTTCTTTACCACATCCAGGG - Intergenic
1029866405 7:103635406-103635428 CAAATGCTTTCCAACATACCTGG + Exonic
1031618954 7:123912941-123912963 CATATTGTTTACCATTTACCTGG + Intergenic
1033621536 7:143066180-143066202 CAAATTCTTAATCACCCACCAGG + Intergenic
1034134195 7:148750604-148750626 CATGTTCTTTACCACGGACATGG - Intronic
1044578220 8:93794372-93794394 AAAAATATTTACCATGTACCAGG + Intronic
1047087326 8:121532576-121532598 CAAAATCTATTCCACGTACAGGG - Intergenic
1048127383 8:131651239-131651261 AAAAATCTTTATCAAGTACCTGG + Intergenic
1050008992 9:1165796-1165818 CAATTTCTTAACCCAGTACCTGG - Intergenic
1052268679 9:26603953-26603975 CTAAGTCATTACCAAGTACCAGG + Intergenic
1053556334 9:39141581-39141603 CAAATGTTTTACCAAGTACAAGG + Intronic
1057713189 9:97465791-97465813 CAAATTCTCTATCAAGTAGCAGG - Intronic
1057979369 9:99643865-99643887 CAAATTGTCTCCCATGTACCAGG - Intergenic
1059427567 9:114230784-114230806 CTGATTCTTTACCCCGTATCAGG - Intronic
1191780861 X:64863709-64863731 CAAGTTCTTTACCTAGTCCCTGG - Intergenic
1194382460 X:93211487-93211509 TAAATTCTTTACCACTTACATGG - Intergenic
1195879701 X:109579649-109579671 CATATTCTTTACCACCAACAAGG + Intergenic
1198832043 X:140760944-140760966 CTATTTCTTTCCCATGTACCAGG + Intergenic
1201063628 Y:10069493-10069515 AATATTCTGTACCACCTACCTGG - Intergenic