ID: 907813371

View in Genome Browser
Species Human (GRCh38)
Location 1:57894377-57894399
Sequence GTATGTGCTCATTTTAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907813367_907813371 1 Left 907813367 1:57894353-57894375 CCACTGCTAACAGGGGGAGATAT No data
Right 907813371 1:57894377-57894399 GTATGTGCTCATTTTAGGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 134
907813362_907813371 15 Left 907813362 1:57894339-57894361 CCTGCATGGATTTGCCACTGCTA No data
Right 907813371 1:57894377-57894399 GTATGTGCTCATTTTAGGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907813371 Original CRISPR GTATGTGCTCATTTTAGGTA GGG Intronic
901013747 1:6215890-6215912 GTATCTGCTCATATTAGGAGTGG + Intronic
901941953 1:12669031-12669053 GTATGTCCTTGTATTAGGTAGGG + Intergenic
902319212 1:15648483-15648505 GGATGTGCTCATTTTAAATTTGG + Intronic
903339661 1:22645733-22645755 GTATTTGCTCAGTTGAGATACGG - Intronic
906652595 1:47523439-47523461 GAATTTGCCCATTCTAGGTATGG + Intergenic
906707297 1:47904061-47904083 GTTTGTGCTCAAGTTAGGTTTGG - Intronic
907813371 1:57894377-57894399 GTATGTGCTCATTTTAGGTAGGG + Intronic
908675678 1:66600772-66600794 AAATGTGCTGATTTTAGGCAGGG + Intronic
912872085 1:113317363-113317385 GTATGTTCTCTTTGTATGTATGG - Intergenic
915211421 1:154312554-154312576 GTTTGTACTCATGGTAGGTAGGG + Intergenic
916274882 1:162982967-162982989 GTATGTGTTCATTTTGGATGAGG + Intergenic
917340148 1:173967684-173967706 GTAAGAGCTCATTTTATGTTAGG + Intronic
1066161465 10:32735827-32735849 CTATGAGTTCATTTTTGGTAAGG + Intronic
1067916394 10:50404041-50404063 GTATGAGCTCATTTTAAATTAGG - Intronic
1070725283 10:78783539-78783561 GTAGGTGCTCAGTTAAGGTTAGG - Intergenic
1071801437 10:89066410-89066432 GTATGTACTCTTTTTTGGTCTGG + Intergenic
1072712487 10:97725350-97725372 GTATGTGCTCCTTTTGGGAGAGG + Intergenic
1074507076 10:114080595-114080617 AAACGTGCTCATTATAGGTAAGG + Intergenic
1084528625 11:69713333-69713355 GTGTGTGCTTATTTTAGGGGAGG - Intergenic
1090655831 11:128844586-128844608 GCATGTGCTCATTTTAAGGGAGG + Intronic
1090690567 11:129176507-129176529 GTATGTGGTCAGTTTTGGAATGG - Intronic
1092266404 12:6984366-6984388 GAATGTGCTAATTTTAGTTTAGG - Intronic
1092266898 12:6988484-6988506 GGATGTGCTGTTTTTAGGGAGGG + Intronic
1093305614 12:17513853-17513875 CAATGTCCGCATTTTAGGTATGG + Intergenic
1094464108 12:30732640-30732662 ATATGTACTCATTTTATGTCTGG + Intronic
1097086512 12:56472425-56472447 GTAAGTGCCCATTTGAGGCAGGG + Exonic
1097189720 12:57213711-57213733 GTGGGTGATCATTTTGGGTAGGG - Intergenic
1098277590 12:68828933-68828955 TAATGTTCTCATTTTAAGTAAGG + Intronic
1098456727 12:70682376-70682398 GAAGGTGCTCACTTTATGTAAGG + Intronic
1098670568 12:73225013-73225035 GTATGTCCTCATTGTAGATACGG + Intergenic
1106805771 13:33305249-33305271 GTAAGTGCTCATTAAATGTATGG - Intronic
1107231449 13:38114744-38114766 GTATGTGGTCAATTTCGGAATGG - Intergenic
1115653295 14:35419304-35419326 GCATGTTGACATTTTAGGTAGGG + Intergenic
1117289163 14:54315876-54315898 GGTTGTGATCACTTTAGGTAGGG + Intergenic
1117884847 14:60349742-60349764 GTATTTTCTCATTTGAGGTAAGG + Intergenic
1118814449 14:69300046-69300068 GTGTGTGCACATTTTAGGAAGGG + Intronic
1121505068 14:94470929-94470951 GTAAGTGGTCATTTTAGAGAAGG + Intronic
1126845003 15:52751310-52751332 GTGTGTGCTCATCACAGGTAGGG + Intergenic
1126958104 15:53957426-53957448 GAATGTTCCCATTTTTGGTAGGG - Intergenic
1127743093 15:61933260-61933282 TTAACTGCTCATTTTTGGTAAGG + Intronic
1132219052 15:100091321-100091343 GTAGATTCACATTTTAGGTAAGG + Intronic
1134450247 16:14358890-14358912 GTCTGTGCCCATTTTGGGCAGGG + Intergenic
1137535075 16:49314814-49314836 GAATGTGCACATTTTAGATAGGG + Intergenic
1141448316 16:84078813-84078835 GTATGTGCTCATTTGTGGGGTGG + Intronic
1148949609 17:51299077-51299099 ATATGTGCTTATTTTGCGTATGG + Intergenic
1149278053 17:55067136-55067158 GTACCTGCTCATATTAGATAGGG + Intronic
1155435214 18:25805595-25805617 GTATGTGTTTACTTTACGTAAGG + Intergenic
1158859348 18:61577254-61577276 TCATGTACTCATTTTAGGAATGG + Intergenic
1163530555 19:17846425-17846447 GAATGTGCTCATTCTTGGTCTGG - Intronic
1168033001 19:53696188-53696210 GTATGGGCTCACTTAAGGTCAGG - Intergenic
926861336 2:17312642-17312664 ATATGTGCGCATTTTATGAATGG - Intergenic
926946018 2:18188280-18188302 GCACGTGCTGATTGTAGGTAGGG + Intronic
927323727 2:21779027-21779049 GTATGTGTTTATTTTAGAGATGG + Intergenic
928267197 2:29821860-29821882 GTCTGTGCTCATCTTCGGAAAGG - Intronic
930935117 2:56939638-56939660 GTATGTTATCATATTAGGGAAGG + Intergenic
932393694 2:71422359-71422381 GTTTATGTTCTTTTTAGGTAAGG + Intronic
933509585 2:83223059-83223081 TTGTGTGCCCACTTTAGGTAGGG - Intergenic
933916224 2:86996619-86996641 GTATATTTTCATTTTAGGTTAGG - Intronic
934006769 2:87773283-87773305 GTATATTTTCATTTTAGGTTAGG + Intronic
935770419 2:106414209-106414231 GTATATTTTCATTTTAGGTTAGG + Intronic
935909670 2:107881726-107881748 GTATATTTTCATTTTAGGTTAGG - Intronic
935967789 2:108498604-108498626 GTATATTTTCATTTTAGGTTAGG - Intronic
936131450 2:109846859-109846881 GTATATTTTCATTTTAGGTTAGG - Intronic
936170523 2:110168094-110168116 GTATGTTCACATTTTAGTAAGGG + Intronic
936213247 2:110524626-110524648 GTATATTTTCATTTTAGGTTAGG + Intronic
936422386 2:112379182-112379204 GTATATTTTCATTTTAGGTTAGG + Intronic
938657927 2:133454060-133454082 GTATATGTTCATTTTTAGTACGG + Intronic
939530859 2:143359905-143359927 ATATTTCCTCATTTTAGGTTTGG - Intronic
942845851 2:180424228-180424250 GCATGTGTTCATTTTAAATAGGG + Intergenic
943694340 2:190907929-190907951 GTATGTGCTGATTATATGTGTGG + Intronic
945714433 2:213339983-213340005 GTATAAGGTCATATTAGGTATGG - Intronic
946927575 2:224640791-224640813 GTATGTGCTCTTTTGAGATTGGG + Intergenic
1173936509 20:46870687-46870709 TTATGTGCTCATTCTTGGTAGGG - Intergenic
1175352181 20:58331400-58331422 GTCTGTGGTCATTTCAGATACGG - Intronic
1178037073 21:28596841-28596863 GTATTTTCCCATTTTCGGTATGG - Intergenic
1178952071 21:36993333-36993355 GTTTCTGCTCATGTTAGGTTGGG - Intergenic
1180213381 21:46309656-46309678 GTATGTACTCTTTTTTTGTATGG - Intronic
1182274875 22:29181680-29181702 GTATGTACTCTTTTTTGGTCTGG - Intergenic
949561476 3:5206630-5206652 GTATGTGCTATGTTTAAGTAAGG + Intronic
950466483 3:13158367-13158389 GTGTGTTCTCATTTTGGGTTTGG + Intergenic
951934819 3:28010805-28010827 GTACGTGCTCATTTTAAATAGGG + Intergenic
953016388 3:39080843-39080865 GTATGTGCTTATTTGGGGCAAGG + Intronic
953594987 3:44302594-44302616 GTATGTTTTAATTTTTGGTAGGG + Intronic
953847471 3:46439238-46439260 GTGTGGGCTCATGTTAGGTGAGG - Intronic
954740360 3:52744855-52744877 GGAGGTGCTCATTTTTGGAAGGG + Intronic
955617568 3:60825452-60825474 GTATGTATTCATTATAGGTCGGG + Intronic
959023849 3:101218423-101218445 GTAGGTGCTCATTTTATTTGTGG + Intergenic
959860029 3:111206312-111206334 GTATGTGCTCATTCTAATGAAGG + Intronic
962934547 3:140067707-140067729 GTGAGTGGTCATTTTAGGAAGGG + Intronic
963001010 3:140681767-140681789 ATTTGGGCTCATGTTAGGTAAGG + Intronic
964502573 3:157365169-157365191 GTAGGTGCTTATTCTAGCTAAGG - Intronic
964826316 3:160832105-160832127 GTATGTGTTCATTTTATTCAGGG + Intronic
965036418 3:163444532-163444554 TTCTTTGCTCCTTTTAGGTAAGG - Intergenic
965923927 3:173953927-173953949 TTATGTGCTCATCCCAGGTATGG + Intronic
966574712 3:181487481-181487503 TTCTGTCTTCATTTTAGGTAAGG - Intergenic
972374196 4:38455676-38455698 GTATGTGCTCAATCTGGGCAAGG - Intergenic
973162105 4:47031871-47031893 GTTTGTGCTCATTTTGAATACGG + Intronic
974090709 4:57307826-57307848 ATGTGTTCTCATTTTAGGTTTGG - Intergenic
977184468 4:93919360-93919382 GTATGTCCTCACTTTAAGTGGGG - Intergenic
977894785 4:102351214-102351236 TTATTTGAGCATTTTAGGTATGG - Intronic
982838595 4:160154592-160154614 GTATGTGGTCAATTTTGGAATGG + Intergenic
983878669 4:172907172-172907194 GTATGTGCTCCTTAAAGGTTTGG - Intronic
986928605 5:12791066-12791088 ATATGTGCTCACTTTCGGTTTGG - Intergenic
991355229 5:65762243-65762265 GTATGTGTGCATTTGGGGTAGGG + Intronic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
996030713 5:118701616-118701638 ATATGTGCTCATTTTTGGTTTGG - Intergenic
997345074 5:133184142-133184164 GTATGTGGTCAATTTTGGAATGG + Intergenic
997847555 5:137301658-137301680 GTATGTTCTCATTTTGGGCAAGG + Intronic
999548421 5:152657385-152657407 GTATGTGGTCAATTTTGGAATGG + Intergenic
1001460778 5:171911743-171911765 ATATGTACTGATTTTATGTAAGG - Intronic
1003728719 6:8795390-8795412 GTATGGGCTTATTTTATTTAAGG + Intergenic
1005918736 6:30379306-30379328 GTAAGTGCTCATTTTGCTTATGG + Intergenic
1008438632 6:51506468-51506490 GTATTTGTTCTTTTTACGTAAGG - Intergenic
1009419366 6:63447823-63447845 GTAGATGCTAATTTCAGGTATGG + Intergenic
1010316341 6:74455093-74455115 GTATATTCTCATTTTAGTCATGG + Intergenic
1013158495 6:107518725-107518747 ATATGTGCACAATTTAGGAAAGG + Intronic
1014722650 6:124936664-124936686 TTATTTGTTCATTTTAGTTATGG + Intergenic
1014917180 6:127165075-127165097 GTAATAGCACATTTTAGGTAAGG + Intronic
1018300224 6:162394310-162394332 GTACGTGTTCATTTTAGGCCAGG - Intronic
1022590805 7:31660594-31660616 TTTTGTGCTCCTTTTATGTACGG - Intergenic
1026542141 7:71288956-71288978 TAATGTGCCCATTTTATGTATGG + Intronic
1027441221 7:78221001-78221023 GTGTGTGCTCAGTACAGGTACGG - Intronic
1028722066 7:94044689-94044711 GTATGTGCACATTTGTGTTAGGG + Intergenic
1029360452 7:100084584-100084606 GCAAGTGCTCCTTTTTGGTATGG - Intergenic
1029608930 7:101616293-101616315 GTATGTGCTGCTTATAGGCACGG - Exonic
1030556660 7:111033187-111033209 ATATGTATTCATTTTAGATAGGG - Intronic
1031920982 7:127600383-127600405 GTATCTGGGAATTTTAGGTAAGG + Exonic
1034935802 7:155199900-155199922 GTATGTGATCATTTCAGTGATGG - Intergenic
1039326168 8:36488060-36488082 GTATGTGGTCAATTTTGGAATGG + Intergenic
1041153614 8:54961409-54961431 GTATGTGCTCATTTTGCTTTGGG - Intergenic
1047137192 8:122093118-122093140 GAATGTGTTCATTTTGGGTTAGG + Intergenic
1047932422 8:129743199-129743221 GTTTTTGCTCACTTTAGTTATGG + Intergenic
1052725945 9:32228466-32228488 GTATGTGGTCAATTTTGGAATGG + Intergenic
1053180600 9:35965238-35965260 GTATGTGTTCATTTCTCGTAGGG + Intergenic
1056051331 9:82772788-82772810 GTATGTGGTCAATTTTGGAATGG + Intergenic
1185968089 X:4630526-4630548 GTCTGTGCTCACTTTATCTATGG - Intergenic
1186383601 X:9086959-9086981 GTATGAGCTCATTTTCAGTGGGG - Intronic
1187092651 X:16113463-16113485 GAATGTGCCCATGTTAGGTTTGG + Intergenic
1188433256 X:30130929-30130951 GTGTGTGCACATTTTTGGCAAGG - Intergenic
1189369332 X:40415467-40415489 CTATGAGCTCTTTTGAGGTAGGG - Intergenic
1193198444 X:78660051-78660073 CTATGTGGCCATTTTAGGCAAGG + Intergenic
1194574513 X:95595590-95595612 GTATGTGTTCATATGAGTTAAGG + Intergenic
1195108298 X:101621490-101621512 GTATTTGTTCATTTTAAGAAGGG + Intergenic
1201609384 Y:15823752-15823774 GTAAGTTCTCACTTCAGGTATGG + Intergenic