ID: 907816034

View in Genome Browser
Species Human (GRCh38)
Location 1:57919097-57919119
Sequence TCCAGGGACACATAGTGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907816034_907816042 11 Left 907816034 1:57919097-57919119 CCCATTCACTATGTGTCCCTGGA 0: 1
1: 0
2: 3
3: 13
4: 206
Right 907816042 1:57919131-57919153 TACTCTCCATTTCCTCCACCTGG No data
907816034_907816044 20 Left 907816034 1:57919097-57919119 CCCATTCACTATGTGTCCCTGGA 0: 1
1: 0
2: 3
3: 13
4: 206
Right 907816044 1:57919140-57919162 TTTCCTCCACCTGGAAATTGTGG 0: 1
1: 0
2: 3
3: 56
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907816034 Original CRISPR TCCAGGGACACATAGTGAAT GGG (reversed) Intronic
900354907 1:2256340-2256362 TCCAGGAACACACAGTGGAGAGG - Intronic
906656421 1:47551759-47551781 ACCAAGGTCACATAGTGAGTTGG + Intergenic
906832352 1:49046620-49046642 TGCAGGGAAACATTGTGAAGAGG - Intronic
906922243 1:50076996-50077018 TCCAGAGAAACAAAGTAAATGGG + Intronic
907239934 1:53075756-53075778 TGCAGGGAGACACAGTGAAGGGG + Intronic
907816034 1:57919097-57919119 TCCAGGGACACATAGTGAATGGG - Intronic
907832363 1:58077259-58077281 TCCAAGGTCACATAGCAAATAGG + Intronic
910420223 1:87052875-87052897 TCCAGGAACACTTTGAGAATCGG - Intronic
910703842 1:90105368-90105390 TGCAGGAACACATAGTGACAAGG - Intergenic
911426678 1:97724263-97724285 TCCAGAGACACAGAAAGAATAGG + Intronic
911668728 1:100584761-100584783 TCCAGGGACACAGAGTTTCTGGG + Intergenic
914204752 1:145517406-145517428 TCAGGAGCCACATAGTGAATTGG + Intergenic
914370809 1:147022821-147022843 TCAGGAGCCACATAGTGAATTGG - Intergenic
915576002 1:156777721-156777743 TGTAGGGACACCTAGTGAAAAGG + Intronic
916001708 1:160622988-160623010 ACAAGGGACAAATGGTGAATGGG + Intronic
916440188 1:164817270-164817292 TCCACTGACAAATAGTGAATGGG - Intronic
916688481 1:167169387-167169409 TCCAGAGAGACAGAATGAATAGG + Intergenic
916769498 1:167894372-167894394 TCCAGGGTCACACAGTGAAGCGG - Intronic
917820113 1:178754193-178754215 TCCAGAGAAACAGAATGAATAGG + Intronic
919468774 1:197953158-197953180 TACAGGGTCAAATAGTAAATAGG + Intergenic
1065835497 10:29654583-29654605 TCCAGAGAGACAGAATGAATAGG + Intronic
1066051105 10:31636506-31636528 TCCAAAGAAACATAATGAATAGG + Intergenic
1066377591 10:34871713-34871735 TCCAGGGACACCCAGTCACTGGG + Intergenic
1067373082 10:45702852-45702874 TAAAGGGACACAGAGTGATTGGG + Intergenic
1067386693 10:45823270-45823292 TAAAGGGACACAGAGTGATTGGG - Intergenic
1067447575 10:46361337-46361359 TAAAGGGACACAGAGTGATTGGG + Intergenic
1067589805 10:47499430-47499452 TAAAGGGACACAGAGTGATTGGG - Intergenic
1067636929 10:48007530-48007552 TAAAGGGACACAGAGTGATTGGG - Intergenic
1067876562 10:50012805-50012827 TAAAGGGACACAGAGTGATTGGG + Intergenic
1068059445 10:52049174-52049196 AACAGGGATACAAAGTGAATGGG + Intronic
1068174215 10:53436892-53436914 TCCATAGACACATAGTGACCTGG + Intergenic
1069303171 10:66934057-66934079 TCCAGGAACACAGAGAGAACAGG + Intronic
1069595607 10:69668011-69668033 TCCAGAGACACAGAGCCAATAGG + Intergenic
1070133476 10:73671550-73671572 TAAAGGGACACAGAGTGATTGGG - Intergenic
1070502805 10:77087400-77087422 TCCAGTGAAACAGAGTCAATAGG - Intronic
1071608194 10:87012529-87012551 TAAAGGGACACAGAGTGATTGGG + Intergenic
1072848529 10:98860158-98860180 TCCAGGGAAACAGAATAAATAGG - Intronic
1074488793 10:113919071-113919093 GCCAGAGACACTTAGTGAAAGGG - Intergenic
1075153006 10:119952096-119952118 TGAAGAGACAAATAGTGAATTGG + Intergenic
1079584719 11:22111665-22111687 TCCAGAGAGACATATCGAATAGG - Intergenic
1079946949 11:26755676-26755698 TGCAAGGATACATAGTGACTTGG + Intergenic
1080160694 11:29171771-29171793 TTCAGGGACACATAGCTAGTGGG - Intergenic
1080679249 11:34458707-34458729 TCCAGAGACCCATGGTGACTTGG - Intronic
1084399901 11:68937426-68937448 TCCAGGGCCACATGTTGCATGGG - Intronic
1084872088 11:72105203-72105225 TCCAGGGACCTATGGGGAATGGG - Intronic
1085008343 11:73115563-73115585 TTCAGAGAAACAGAGTGAATAGG + Intronic
1085282144 11:75338158-75338180 TCCAGTGCCACCTAGAGAATGGG + Intronic
1088824193 11:113479985-113480007 TACAGAGACAGAGAGTGAATTGG + Intergenic
1089701658 11:120248204-120248226 TCTAAGGTCACATATTGAATTGG - Intronic
1090963464 11:131577860-131577882 TCCAGGGAAATGTAGTGAATTGG + Intronic
1091511248 12:1128883-1128905 TGCAGGAACAGTTAGTGAATTGG + Intronic
1091806445 12:3360005-3360027 TCCAGGGATCCACAGTGCATGGG + Intergenic
1094261913 12:28510212-28510234 TCCAGAGAGACAGAGTCAATAGG + Intronic
1094661110 12:32471367-32471389 TCCAGAGACACATAACAAATAGG - Intronic
1095340984 12:41088007-41088029 TCCAGAGAAACAGAATGAATAGG + Intergenic
1097058665 12:56266617-56266639 TCTAGAGGGACATAGTGAATAGG - Intergenic
1099111460 12:78567308-78567330 TCCAGAGATACATAGCCAATAGG + Intergenic
1099229766 12:80009702-80009724 TACATGGACAAATAGTGAAGTGG + Intergenic
1099618068 12:84964417-84964439 TCCAGGGAAACAGAGCTAATAGG - Intergenic
1101094278 12:101320243-101320265 TCCAGATTCACATAGAGAATCGG + Intronic
1103527212 12:121576977-121576999 CCCAGGGGCTCACAGTGAATGGG + Intronic
1104050316 12:125190138-125190160 TTCAGGGTCACACAGTGAATTGG + Intronic
1106066911 13:26362163-26362185 TCCAGAGAAACAGAGTCAATAGG + Intronic
1107784521 13:43941747-43941769 TCCAGTGAAACAGAGTCAATGGG - Intergenic
1110873394 13:80479466-80479488 TCTAAGGTCACATAGTTAATAGG + Intergenic
1113659457 13:112095653-112095675 TTCAGGGAGACACAGGGAATCGG - Intergenic
1114434296 14:22691374-22691396 TCCAGGGTCACATTGTTAGTAGG + Intergenic
1115981067 14:39052002-39052024 TGCAGGGACACAGATGGAATTGG + Intronic
1120194483 14:81467241-81467263 TACAGGGTGACACAGTGAATCGG - Intergenic
1121773615 14:96575090-96575112 CCCAGGGTCACACAGTAAATTGG + Intergenic
1123626313 15:22229170-22229192 TACAGGGACAGAAAGTGGATGGG + Intergenic
1125175670 15:36818687-36818709 TCCAGGGTCACATAGCTAATAGG + Intergenic
1125603383 15:40927520-40927542 TCCAGGGATCCATAGGGTATAGG + Intergenic
1126222739 15:46233050-46233072 TCCCAGGACACATAGTGAACTGG + Intergenic
1129356733 15:74996489-74996511 CCCAGGGACACAGAGAGAAAGGG + Intronic
1129395931 15:75246356-75246378 TCCAAGGGCACATAGTCAAGTGG - Intergenic
1129405646 15:75315501-75315523 TCCAAGGGCACATAGTCAAGTGG - Intergenic
1129941618 15:79501930-79501952 TCCAGAGAAACAGAATGAATAGG - Intergenic
1131434697 15:92413596-92413618 TCCCGGGACACATCTGGAATAGG - Intronic
1132284404 15:100650936-100650958 TCCATGGTCACATAATGAATAGG + Exonic
1133792234 16:9017879-9017901 TCCAGAGCCTCATTGTGAATGGG - Intergenic
1135155467 16:20049092-20049114 TCCAGGGGCTCCCAGTGAATGGG - Intronic
1138162869 16:54772574-54772596 TACAGGGACACACTGGGAATGGG + Intergenic
1138917845 16:61489167-61489189 CCCATGGATACACAGTGAATAGG + Intergenic
1141163250 16:81643332-81643354 TCCAGGAACAGAAAGTGGATTGG + Intronic
1141977663 16:87528201-87528223 TACAGGGACAGAAAGTGGATGGG - Intergenic
1142326323 16:89417417-89417439 TCCAGAGACGCATGGTGAACTGG - Intronic
1144457628 17:15432093-15432115 TCCAGGGACACACGGTAAACTGG + Intergenic
1147760526 17:42795043-42795065 TCCAGGGACACTGAGAGAGTGGG - Exonic
1148396950 17:47316414-47316436 TCCAGTGACTCATACAGAATTGG + Intronic
1148603524 17:48911020-48911042 TCCAAGGTCACATAGTGAGGTGG + Intronic
1149730921 17:58945487-58945509 TCCAGGGAGAAATGGAGAATTGG - Intronic
1152670697 17:81603700-81603722 TAGAGGGACAGATAGTGCATAGG - Intronic
1153970244 18:10219841-10219863 TTCTTGGAGACATAGTGAATTGG + Intergenic
1155552683 18:26982567-26982589 ACGGGGGACACACAGTGAATGGG + Intronic
1156075176 18:33266833-33266855 TCCAGGGACACAAACTGGAGAGG + Intronic
1156153222 18:34267646-34267668 TCCAGAGAAACATAATGAAGAGG - Intergenic
1157302516 18:46489218-46489240 TCCAGGGCCACACAGCCAATGGG - Intronic
1157440512 18:47708053-47708075 TCCAGAGAAACACAATGAATAGG - Intergenic
1158841256 18:61390160-61390182 TACTGGGATACATGGTGAATGGG - Intronic
1160985255 19:1835699-1835721 TTCTGGGAAACATGGTGAATTGG + Intronic
1162976285 19:14208415-14208437 TCCCTGGACATATAGGGAATGGG - Intergenic
1164010553 19:21199944-21199966 TCCTGGGTCACAGACTGAATAGG + Intergenic
1164584549 19:29458666-29458688 CCCAAGGACACCTACTGAATGGG + Intergenic
1164911511 19:32016005-32016027 TCCAGAGAAACAGAGTCAATGGG + Intergenic
1165290870 19:34884290-34884312 TCCAGGGAGACAGAATAAATAGG - Intergenic
1166105195 19:40594731-40594753 TCCAGGGACACACAGTCCCTGGG - Intronic
1166856521 19:45785079-45785101 TCCAGGGTCACAGAGGGAGTGGG + Intronic
1167591920 19:50408911-50408933 TCGGGGGACACATGCTGAATTGG - Intronic
925183359 2:1831036-1831058 GCCAAGGACACACAGGGAATTGG - Intronic
925550703 2:5071104-5071126 ACCAAGATCACATAGTGAATGGG + Intergenic
925781611 2:7387074-7387096 TCCAGAGACACAGAGCCAATAGG - Intergenic
927768155 2:25832895-25832917 TCCAGAGACATACAATGAATGGG + Intronic
928207606 2:29297432-29297454 TCCAAGGTCACAAAGTAAATTGG - Intronic
930204116 2:48571561-48571583 TCCAGGGTCTCAAAGTGCATAGG + Intronic
931745268 2:65286433-65286455 CCCAGGGACACACAGTGAATCGG - Intergenic
935125698 2:100220608-100220630 TCCAGAGAAACAGAGTCAATAGG - Intergenic
941826998 2:169910092-169910114 TCCAAGTAGAAATAGTGAATAGG + Intronic
942903203 2:181147827-181147849 TCCAGGCAAAGAGAGTGAATAGG + Intergenic
944444616 2:199776791-199776813 TCCAGAGAAACAGAATGAATAGG + Intronic
945903807 2:215568459-215568481 TTCAGGAAAAGATAGTGAATTGG + Intergenic
946615749 2:221508035-221508057 TCCAGGGACACATTTTGCCTGGG - Intronic
1170819972 20:19748799-19748821 TCAAGGGAAACACATTGAATGGG + Intergenic
1172441287 20:34968460-34968482 TTCAAGGTCACATAGTGAGTTGG + Intergenic
1172994124 20:39057515-39057537 TCCAGGGACACAGAGTGAGTAGG - Intergenic
1173095305 20:40022069-40022091 CCCAGGGTCACTTAGTTAATTGG - Intergenic
1173687354 20:44932952-44932974 TCCAGGGCCACCAAGAGAATGGG - Intronic
1175427403 20:58877348-58877370 GCCAGGGGCAAATGGTGAATAGG + Intronic
1175585934 20:60140056-60140078 TCCTGGGAGACATAGTGATCTGG - Intergenic
1176038169 20:63050353-63050375 TCCAGTGTCACTGAGTGAATGGG + Intergenic
1177817192 21:25990277-25990299 TCCATGGACACATACTGACATGG + Intronic
1178049374 21:28731464-28731486 TCTAAGGACACAGAGAGAATGGG - Intergenic
1181108897 22:20590156-20590178 TCTAGGGAGACACAGAGAATGGG - Intergenic
1181539500 22:23565876-23565898 TCCAGGGACACACAGTAAGCAGG - Intergenic
1182828850 22:33288529-33288551 TCCAGAGACACAGAGCCAATAGG - Intronic
1183118928 22:35714462-35714484 TCGAGGGCCACATAGTGAGAAGG - Intergenic
1183227219 22:36558794-36558816 TCCAGGCTTACACAGTGAATCGG - Intergenic
1184386316 22:44177083-44177105 TCCAGGTAAACATAGTGATATGG - Intronic
952056764 3:29456515-29456537 TCCAGTGGCACACAGTGGATTGG - Intronic
953051767 3:39350704-39350726 TCCTGGGTCACAGACTGAATAGG - Intergenic
953388525 3:42520941-42520963 TCCAGGGACACCCAGTGCCTGGG + Intronic
956900078 3:73706499-73706521 CCCAAGGTCACATAGTTAATAGG + Intergenic
959483587 3:106902498-106902520 TTCAGGGACCCAAAGTGAAAAGG - Intergenic
961062019 3:123836793-123836815 TCCAAGGACACATAGTAGAGAGG + Intronic
963360094 3:144261043-144261065 TCCAGGGATATATAGTGTAAAGG + Intergenic
963893055 3:150657569-150657591 TCCAGGGAAACTGAGTGACTGGG - Intergenic
964298777 3:155263735-155263757 TCCAGGGCCAAATATTGAGTAGG + Intergenic
965114960 3:164477403-164477425 TCCTGGGCCACCAAGTGAATAGG - Intergenic
969992417 4:11278157-11278179 TGCAGGCACTCATAGTCAATTGG - Intergenic
971552185 4:27971335-27971357 TCCAGAGACACATAAGCAATGGG - Intergenic
971756953 4:30718843-30718865 TCAAGGGACACAAAGTCAAAAGG + Intergenic
971775104 4:30953149-30953171 TCCAGGGACACAAAGTCTAGAGG + Intronic
980590519 4:134881835-134881857 TCAAGGGTCACAAAGTAAATAGG + Intergenic
980828918 4:138106050-138106072 TCCAGAGAAACAGAGTCAATAGG - Intergenic
985035611 4:185837231-185837253 TCTAGGGACAAATAGTTGATAGG - Intronic
986995233 5:13600118-13600140 TCCATGGAGACATAATAAATGGG + Intergenic
988857267 5:35240420-35240442 CCCAGGGACACATATTGAATAGG - Intergenic
988943491 5:36169805-36169827 TCCAGGGTCACATTGTTAGTAGG + Intronic
989239164 5:39183633-39183655 TTTAGGGACACATAGAGAGTAGG - Intronic
992120718 5:73589302-73589324 TTCAGGGAAACAGAATGAATAGG + Intergenic
992266758 5:75026357-75026379 TACAGTGACACATTGAGAATGGG - Exonic
992733492 5:79695653-79695675 ACCAGGGACACAAAGAGGATTGG + Intronic
993185110 5:84607728-84607750 TCCAGGGAAACAGAATCAATAGG + Intergenic
996438759 5:123465318-123465340 TCCAGAGAAACAGAATGAATAGG - Intergenic
998372417 5:141670462-141670484 TACAGGGACAGAAAGTGGATGGG - Intronic
998786041 5:145709937-145709959 TCCAGGGACAGAAATTAAATGGG - Intronic
999247575 5:150163455-150163477 TCCACGGACACATCCTGGATTGG - Intergenic
999512612 5:152268463-152268485 TTCAGGGAGACATTCTGAATTGG + Intergenic
999517803 5:152318512-152318534 TCCAGAGACACATAGAGAGAAGG - Intergenic
1001386244 5:171341697-171341719 ACAAAGGACAAATAGTGAATAGG - Intergenic
1004638920 6:17495143-17495165 TCCAGGGAAACACAATGAATAGG - Intronic
1005260779 6:24056948-24056970 TCCAGAGAGACAGAATGAATAGG - Intergenic
1007324579 6:41050182-41050204 TCCAAGATCACACAGTGAATCGG + Intronic
1007790137 6:44304045-44304067 CCCAGGGTCCCATAGTGATTGGG + Intronic
1011299289 6:85857091-85857113 TCCTGGGTCACAAATTGAATAGG + Intergenic
1012079451 6:94736836-94736858 TCCAGGGACTCCTAGTGATAGGG + Intergenic
1013630714 6:111983466-111983488 TCCAGGGACACATACACAAAAGG - Intergenic
1014400856 6:120987866-120987888 TCCAGAGAAACAGAATGAATAGG + Intergenic
1016129386 6:140447020-140447042 TCCAGTGACACATATGGAAATGG - Intergenic
1018440346 6:163806551-163806573 TCCAGGGAAACAGAATCAATAGG + Intergenic
1022805197 7:33814429-33814451 TCCAGTGACACAGAGAGAACTGG - Intergenic
1024422218 7:49182103-49182125 TCCAGGGAAACATAGCTAAGAGG + Intergenic
1024497605 7:50066352-50066374 TCCTGGGTCACAGACTGAATAGG + Intronic
1028098546 7:86792554-86792576 TCCAAGTTCACATAATGAATAGG + Intronic
1029328991 7:99835609-99835631 TCCTGGGTCACAGACTGAATAGG + Intronic
1029608871 7:101616028-101616050 TCCACGCACACATAGAGAAGGGG + Intronic
1030646442 7:112066745-112066767 TCCAGAGACACAGAGCCAATAGG - Intronic
1031708887 7:125019857-125019879 TCCAGGGACACATGGTTAGTTGG + Intergenic
1032396131 7:131591461-131591483 TCCAGGGTCACACAGGTAATAGG + Intergenic
1032860821 7:135877683-135877705 TCCAAGGTCACACAGTTAATGGG - Intergenic
1033109101 7:138559158-138559180 TCCTGGGTCACAGATTGAATAGG + Intronic
1033992809 7:147308629-147308651 TTCAGGGAAACACAGTGAAGTGG - Intronic
1039124245 8:34183247-34183269 TCTAGGGAAACATAGTCAATTGG - Intergenic
1040652349 8:49463951-49463973 TCCAGGGAGACAGAATCAATAGG + Intergenic
1040887366 8:52279650-52279672 TGAAGGGAAATATAGTGAATTGG + Intronic
1040944913 8:52874243-52874265 TCCACTGACACACAGTGAAGGGG + Intergenic
1042068327 8:64903110-64903132 TTCACGCTCACATAGTGAATGGG + Intergenic
1046087470 8:109455972-109455994 TACAGGGACACAATGTAAATGGG - Intronic
1046627070 8:116586287-116586309 TCCAGGGAAACAGAATCAATAGG + Intergenic
1050168298 9:2789363-2789385 TCCAGGGACTCATATTTAATTGG - Intronic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1057959159 9:99438183-99438205 TCCAGGGACAGAGAAGGAATGGG - Intergenic
1059540789 9:115128374-115128396 TGCAGGAAAACATAGTGAAGAGG - Intergenic
1059686860 9:116646100-116646122 TTCAGCATCACATAGTGAATGGG + Intronic
1059700924 9:116775076-116775098 TTCAGGGACACATAATAAAAGGG + Intronic
1060231029 9:121825375-121825397 ACCAGGGACACACAGTTCATGGG - Intronic
1061243809 9:129390977-129390999 TCTGGGGTCACATAGTAAATGGG + Intergenic
1061275637 9:129568357-129568379 TCCAGGGACACACAGTAAGCAGG - Intergenic
1061794553 9:133078206-133078228 TCCTGGGTCACAAATTGAATAGG + Intronic
1061910374 9:133719198-133719220 TCAAGTTACACACAGTGAATGGG + Intronic
1185561789 X:1065433-1065455 TTCAGTTACACATAGTGAAGTGG + Intergenic
1186308207 X:8288181-8288203 TCCAGAGAAACAGAATGAATAGG - Intergenic
1189785990 X:44559176-44559198 TCCATGGGCACACAGAGAATTGG + Intergenic
1190129620 X:47735093-47735115 TCCAGAGACACAGAGCCAATAGG + Intergenic
1190721284 X:53150814-53150836 TCCAGGGAAACAGAATCAATAGG + Intergenic
1191716677 X:64198455-64198477 TCCAAGGTCACATAGTGAAATGG + Intronic
1191940628 X:66476957-66476979 TCCAAGGTCTCACAGTGAATTGG - Intergenic
1195403373 X:104485964-104485986 TGCAGGGACACATAATTAAAAGG - Intergenic
1196867358 X:120082346-120082368 TCCTGGGTCACAGAATGAATAGG + Intergenic
1196875741 X:120153936-120153958 TCCTGGGTCACAGAATGAATAGG - Intergenic
1198096627 X:133386283-133386305 ACCAGGGACACAAATGGAATAGG + Intronic
1199507508 X:148581925-148581947 TCCAGGGTCACATGGTGCATTGG + Intronic
1199998420 X:153042464-153042486 TCCAGAGAAACATAATCAATAGG + Intergenic