ID: 907816145

View in Genome Browser
Species Human (GRCh38)
Location 1:57919969-57919991
Sequence CTATAAATCCAGATTAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907816145_907816149 13 Left 907816145 1:57919969-57919991 CCCAGCCTAATCTGGATTTATAG No data
Right 907816149 1:57920005-57920027 TAAATTGCTCTAAGTGCTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907816145 Original CRISPR CTATAAATCCAGATTAGGCT GGG (reversed) Intronic
No off target data available for this crispr