ID: 907816145 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:57919969-57919991 |
| Sequence | CTATAAATCCAGATTAGGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 907816145_907816149 | 13 | Left | 907816145 | 1:57919969-57919991 | CCCAGCCTAATCTGGATTTATAG | No data | ||
| Right | 907816149 | 1:57920005-57920027 | TAAATTGCTCTAAGTGCTTCAGG | 0: 1 1: 0 2: 0 3: 7 4: 128 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 907816145 | Original CRISPR | CTATAAATCCAGATTAGGCT GGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||