ID: 907819370

View in Genome Browser
Species Human (GRCh38)
Location 1:57952238-57952260
Sequence CATGCCAATCCTCAAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907819370_907819380 23 Left 907819370 1:57952238-57952260 CCCCTCTCTTGAGGATTGGCATG No data
Right 907819380 1:57952284-57952306 CTTTGCTCATAAAGACAATGGGG 0: 1
1: 0
2: 0
3: 21
4: 324
907819370_907819377 -9 Left 907819370 1:57952238-57952260 CCCCTCTCTTGAGGATTGGCATG No data
Right 907819377 1:57952252-57952274 ATTGGCATGGGAGTATGATGGGG No data
907819370_907819376 -10 Left 907819370 1:57952238-57952260 CCCCTCTCTTGAGGATTGGCATG No data
Right 907819376 1:57952251-57952273 GATTGGCATGGGAGTATGATGGG 0: 1
1: 0
2: 0
3: 20
4: 133
907819370_907819379 22 Left 907819370 1:57952238-57952260 CCCCTCTCTTGAGGATTGGCATG No data
Right 907819379 1:57952283-57952305 TCTTTGCTCATAAAGACAATGGG No data
907819370_907819378 21 Left 907819370 1:57952238-57952260 CCCCTCTCTTGAGGATTGGCATG No data
Right 907819378 1:57952282-57952304 ATCTTTGCTCATAAAGACAATGG 0: 1
1: 0
2: 2
3: 15
4: 256
907819370_907819381 24 Left 907819370 1:57952238-57952260 CCCCTCTCTTGAGGATTGGCATG No data
Right 907819381 1:57952285-57952307 TTTGCTCATAAAGACAATGGGGG 0: 1
1: 0
2: 0
3: 20
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907819370 Original CRISPR CATGCCAATCCTCAAGAGAG GGG (reversed) Intronic
No off target data available for this crispr