ID: 907820041

View in Genome Browser
Species Human (GRCh38)
Location 1:57958310-57958332
Sequence CTGTGATACACTGGGTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907820038_907820041 11 Left 907820038 1:57958276-57958298 CCTGATGTGCTTTTTAAAAATCA 0: 1
1: 1
2: 6
3: 97
4: 735
Right 907820041 1:57958310-57958332 CTGTGATACACTGGGTAAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 107
907820035_907820041 21 Left 907820035 1:57958266-57958288 CCGTACCCAGCCTGATGTGCTTT No data
Right 907820041 1:57958310-57958332 CTGTGATACACTGGGTAAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 107
907820034_907820041 24 Left 907820034 1:57958263-57958285 CCACCGTACCCAGCCTGATGTGC 0: 1
1: 2
2: 25
3: 255
4: 1867
Right 907820041 1:57958310-57958332 CTGTGATACACTGGGTAAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 107
907820037_907820041 15 Left 907820037 1:57958272-57958294 CCAGCCTGATGTGCTTTTTAAAA 0: 1
1: 0
2: 13
3: 130
4: 836
Right 907820041 1:57958310-57958332 CTGTGATACACTGGGTAAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 107
907820036_907820041 16 Left 907820036 1:57958271-57958293 CCCAGCCTGATGTGCTTTTTAAA 0: 1
1: 1
2: 12
3: 122
4: 928
Right 907820041 1:57958310-57958332 CTGTGATACACTGGGTAAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907820041 Original CRISPR CTGTGATACACTGGGTAAGT TGG Intronic
903391164 1:22964465-22964487 CTCTGGTGCACTGGGCAAGTCGG - Intronic
905217781 1:36421563-36421585 CTGTGGTACCCTGGGAAAGACGG - Intronic
907820041 1:57958310-57958332 CTGTGATACACTGGGTAAGTTGG + Intronic
912595372 1:110870807-110870829 CTGTGTTACTCTGTGTATGTTGG - Intergenic
916391455 1:164335329-164335351 CTGTGTGACCTTGGGTAAGTGGG + Intergenic
922979005 1:229809260-229809282 CTGTGCCACACTGGGTTGGTGGG - Intergenic
1063475726 10:6327408-6327430 CTGTGAGACACTGGTTAATCCGG + Intergenic
1065170554 10:23022913-23022935 CTGAGAAACACTGGGCAGGTGGG + Intronic
1067248364 10:44565647-44565669 CTGAGATCCACAAGGTAAGTGGG + Intergenic
1069530645 10:69216659-69216681 CTGTGCTACACTGGCTAGGCTGG - Intergenic
1073748907 10:106501509-106501531 CTGTGATACAGTAGGGAGGTGGG - Intergenic
1074080567 10:110165173-110165195 CTGTGTGACTCTGGGTAAGTGGG + Intergenic
1079279082 11:19072108-19072130 CTGTGGAAGACTGGGAAAGTCGG - Intergenic
1080344421 11:31308589-31308611 CTCAGATAAACTGGGTCAGTTGG + Intronic
1082031909 11:47610775-47610797 CTGTGAGACCTTGGGAAAGTTGG - Intergenic
1082881202 11:58040151-58040173 CAGTGATACCCTGAGTAAATTGG + Intronic
1083389490 11:62337561-62337583 CTGCGGTGCCCTGGGTAAGTCGG + Exonic
1085543888 11:77299090-77299112 GTGTGATACTCTGGGTGAGAGGG - Intronic
1087152005 11:94867723-94867745 CTGGGATACCCTGGGCAATTGGG - Intronic
1099759762 12:86903616-86903638 CTGTGGTACACTAGGTAACAAGG + Intergenic
1104369076 12:128206614-128206636 CTGGGATACAATGGGAAAGAAGG + Intergenic
1108325642 13:49328206-49328228 CTGTCATACACTGTGTAAATTGG - Intronic
1109093465 13:58079432-58079454 CTTCAATAAACTGGGTAAGTTGG - Intergenic
1111922404 13:94426266-94426288 CTGTTATTCACTGTGTTAGTGGG - Intergenic
1118361484 14:65061184-65061206 ATGTTGTACACTGGGTGAGTGGG - Exonic
1127862228 15:63003953-63003975 CTGTCAAGCACTGGGTAATTGGG - Intergenic
1133602184 16:7350362-7350384 CTGTGACACAGTGGGTAAAGAGG + Intronic
1134027481 16:10965473-10965495 CTAGGATACACTGGGAAGGTGGG - Intronic
1136501345 16:30670928-30670950 CTGCCATCCACTGGGCAAGTTGG + Intergenic
1145025136 17:19462620-19462642 CTAAGATACAATGGGGAAGTGGG - Intergenic
1147222902 17:38949882-38949904 CAGTGATAGACTGGGCAAGGTGG - Intronic
1148290205 17:46440276-46440298 CTGTTATACACTGGGGAACAAGG - Intergenic
1148312373 17:46657850-46657872 CTGTTATACACTGGGGAACAAGG - Intronic
1149264460 17:54912321-54912343 CTGTGCTACCCTGGGTAAACTGG + Intronic
1150680216 17:67278503-67278525 CTCTGACACACTGAGTAACTGGG - Intergenic
1157154852 18:45255478-45255500 CTGTGATTCTCTGGCAAAGTAGG - Intronic
1160033267 18:75280612-75280634 CTGTGTTACTTTGGGGAAGTCGG + Intronic
1164404950 19:27936411-27936433 CTGGGATCCCCTGGGTCAGTGGG + Intergenic
1165790618 19:38489486-38489508 CTGGGAGACACAGGGTAGGTGGG + Intronic
925660479 2:6197120-6197142 CTGAGATAAAATGGGTCAGTTGG - Intergenic
929205150 2:39283097-39283119 CACTCATACACTGTGTAAGTAGG - Intronic
929725661 2:44424401-44424423 CCGTGATACATTGCGCAAGTGGG + Intronic
931021416 2:58048199-58048221 CTGTGATAAACTGAGAAAGAGGG + Intronic
932583873 2:73010031-73010053 CTTTGTTAAACTGGGTAACTGGG - Intronic
935950586 2:108325182-108325204 CTGTATTGCCCTGGGTAAGTTGG + Intergenic
936055284 2:109257839-109257861 CTGTGACTCACTGGGAAAGTGGG - Intronic
941798449 2:169627481-169627503 ATTTAATACACTTGGTAAGTGGG + Intronic
946031423 2:216708086-216708108 CTGGGATAAACTGGGTAGGATGG + Intergenic
1170993375 20:21326791-21326813 CTGTGAAATACTGGGGATGTTGG + Intronic
1172906963 20:38377633-38377655 CTGTCACACACAGGGTAAATGGG - Intergenic
1173110452 20:40182799-40182821 CTGTAATACAATGGGTAATAGGG - Intergenic
1177377196 21:20286315-20286337 CTGTGCTAGGCTGGGTATGTTGG - Intergenic
1177582185 21:23038978-23039000 TTTTGATACAGTGGGTAGGTAGG - Intergenic
1181829350 22:25546890-25546912 CTGTGAAACAAAGAGTAAGTAGG - Intergenic
1181983811 22:26785118-26785140 CTGTGTTACCTTGGGCAAGTTGG + Intergenic
1182556548 22:31132287-31132309 CTATGATGCACTGGGTATTTGGG - Intronic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
950602620 3:14048018-14048040 ATGTGATTCACTGGGAAATTAGG - Intronic
956096504 3:65721911-65721933 TTGAGACACACTGGGAAAGTAGG - Intronic
956953750 3:74312740-74312762 ATGTGATATACTGGGTAAAAGGG - Intronic
959610093 3:108284218-108284240 CTGTGAAACACTGGGAAACTGGG + Intergenic
961040715 3:123676150-123676172 ATGGGAGACACTGGGTGAGTTGG + Intronic
963056903 3:141193539-141193561 CTGTGAGGCACTGTGGAAGTGGG - Intergenic
963735282 3:149011821-149011843 ATATGACACACTGGGAAAGTTGG + Intronic
964522047 3:157580502-157580524 CTGGATTATACTGGGTAAGTGGG - Intronic
965011300 3:163095593-163095615 CTGTGTTACCTTGGGCAAGTTGG + Intergenic
969327038 4:6450074-6450096 CTGGGAGACACTGGGTATGGTGG + Intronic
972808203 4:42553038-42553060 CTGTTATACACTGGGGGTGTGGG + Intronic
973641908 4:52911475-52911497 CTGTGCTACACTGGGAATGTTGG + Intronic
973966542 4:56168858-56168880 CTGTGATACTATGGATGAGTAGG + Intergenic
975828663 4:78346415-78346437 CTGTGACACGTTGGGTAAGTGGG - Intronic
978042066 4:104079221-104079243 CAGTAATGCACTGGGTAAATCGG + Intergenic
979664412 4:123294634-123294656 CTCTGAAACACTGAGTTAGTAGG + Intronic
984398415 4:179229513-179229535 ATGTGATAAACTAGGTCAGTTGG - Intergenic
986226837 5:5823641-5823663 CTGTGGTGCCCTGGGGAAGTTGG - Intergenic
990359803 5:55007192-55007214 CTGTGAGGCACTGTGGAAGTGGG - Intronic
991580343 5:68148338-68148360 CTGGGAAACCCGGGGTAAGTTGG - Intergenic
995897388 5:117030622-117030644 ATTTGAGACACTGGGTAAATGGG + Intergenic
996425961 5:123313607-123313629 CTGTGAGGCACTGTGGAAGTGGG + Intergenic
996529417 5:124512126-124512148 GACTGATACACTGGGTATGTAGG - Intergenic
999191405 5:149750203-149750225 CCGTGATTCACTGGGGAGGTTGG - Intronic
999420525 5:151438298-151438320 TTGGGAAGCACTGGGTAAGTAGG - Intronic
1000978009 5:167786053-167786075 GTGTGACACATTGGGTAAGGAGG - Intronic
1001076278 5:168630559-168630581 CATTGATACACTGGTTTAGTAGG + Intergenic
1001287366 5:170433841-170433863 CTGTGAAATCCTGGGTAAATTGG - Intronic
1004562854 6:16767399-16767421 CTGTGTTACACAGTGTAAGGGGG - Intergenic
1007048653 6:38803278-38803300 GTGAAATACACTGGGAAAGTAGG + Exonic
1009952810 6:70415841-70415863 CTGAGATACACAGGTTAAGTGGG - Intronic
1010928425 6:81771231-81771253 CTGTGATACACTTTGTACATAGG + Intergenic
1011971906 6:93236004-93236026 CTGTGATGGACTGGGGAAGCAGG - Intergenic
1012849936 6:104434547-104434569 ATGGGATACACTGGCTATGTAGG - Intergenic
1014183169 6:118407381-118407403 CTGTGAGGCACTGTGGAAGTGGG - Intergenic
1015021960 6:128487337-128487359 CTGTGGCACACTGGGAAACTGGG + Intronic
1017162498 6:151379005-151379027 CTGGGATTCACTTGGTTAGTTGG + Intronic
1020111840 7:5451961-5451983 CTGTGCCACGCTGGGTACGTGGG - Intronic
1023111076 7:36811227-36811249 CTGTGACACACTGGCTTAGAGGG + Intergenic
1023640230 7:42250150-42250172 CAGTGCTACAGTGGGTAACTTGG - Intergenic
1025158738 7:56634869-56634891 CTGTGAGGCACTGTGGAAGTGGG - Intergenic
1040372406 8:46789629-46789651 CTGTGAGGCACTGTGGAAGTGGG + Intergenic
1044837067 8:96306124-96306146 ATGTGATCCACTGGGATAGTCGG - Intronic
1048112054 8:131479029-131479051 TAATGGTACACTGGGTAAGTAGG + Intergenic
1048748687 8:137645834-137645856 CTGTGAAAGACTGGGCAAGCGGG - Intergenic
1048775942 8:137946678-137946700 CTGTGAAACACTGGGCACTTTGG - Intergenic
1049565754 8:143337955-143337977 CCGTGATACATTGTGCAAGTGGG - Intronic
1050291995 9:4164996-4165018 CTTTGGTACACTGGGTTACTGGG + Intronic
1051144294 9:14010127-14010149 CTGAGGTACATTGGGAAAGTGGG + Intergenic
1056397742 9:86196932-86196954 CCATGCTACACAGGGTAAGTAGG - Intergenic
1057938602 9:99261061-99261083 CTGTGGTAGACTGTGTAAGATGG + Intergenic
1060992288 9:127856073-127856095 CTTTGAAAGACTGGGTGAGTTGG + Intergenic
1186449481 X:9660170-9660192 CTTTGATACCATGGGTATGTGGG - Intronic
1187782890 X:22848481-22848503 CTGGGAAACACTGGGTACTTTGG + Intergenic
1192370859 X:70511885-70511907 CTGGGCAACACTGGGTAAATCGG - Intergenic
1193286678 X:79722759-79722781 CTGTTCTCCACTGGGTAATTGGG + Intergenic
1193762911 X:85489223-85489245 CTGTGAGGCACTGTGGAAGTGGG + Intergenic
1194493251 X:94577676-94577698 CTGTGCTACTCTGGCTAAGCTGG - Intergenic