ID: 907820897

View in Genome Browser
Species Human (GRCh38)
Location 1:57967370-57967392
Sequence GTGGGTAGCAAGTACAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907820897_907820902 30 Left 907820897 1:57967370-57967392 CCTGAACTGTACTTGCTACCCAC No data
Right 907820902 1:57967423-57967445 ACACAGGAGTACCTTAACCTAGG 0: 1
1: 0
2: 0
3: 5
4: 114
907820897_907820901 14 Left 907820897 1:57967370-57967392 CCTGAACTGTACTTGCTACCCAC No data
Right 907820901 1:57967407-57967429 TGAACATCATCATAATACACAGG 0: 1
1: 0
2: 0
3: 13
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907820897 Original CRISPR GTGGGTAGCAAGTACAGTTC AGG (reversed) Intronic