ID: 907820899 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:57967388-57967410 |
| Sequence | TTCATCACAGCCTTGATAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 170 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 18, 4: 150} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 907820899_907820901 | -4 | Left | 907820899 | 1:57967388-57967410 | CCCACTATCAAGGCTGTGATGAA | 0: 1 1: 0 2: 1 3: 18 4: 150 |
||
| Right | 907820901 | 1:57967407-57967429 | TGAACATCATCATAATACACAGG | 0: 1 1: 0 2: 0 3: 13 4: 126 |
||||
| 907820899_907820902 | 12 | Left | 907820899 | 1:57967388-57967410 | CCCACTATCAAGGCTGTGATGAA | 0: 1 1: 0 2: 1 3: 18 4: 150 |
||
| Right | 907820902 | 1:57967423-57967445 | ACACAGGAGTACCTTAACCTAGG | 0: 1 1: 0 2: 0 3: 5 4: 114 |
||||
| 907820899_907820904 | 26 | Left | 907820899 | 1:57967388-57967410 | CCCACTATCAAGGCTGTGATGAA | 0: 1 1: 0 2: 1 3: 18 4: 150 |
||
| Right | 907820904 | 1:57967437-57967459 | TAACCTAGGTATACCTGAATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 907820899 | Original CRISPR | TTCATCACAGCCTTGATAGT GGG (reversed) | Intronic | ||