ID: 907820899

View in Genome Browser
Species Human (GRCh38)
Location 1:57967388-57967410
Sequence TTCATCACAGCCTTGATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907820899_907820901 -4 Left 907820899 1:57967388-57967410 CCCACTATCAAGGCTGTGATGAA 0: 1
1: 0
2: 1
3: 18
4: 150
Right 907820901 1:57967407-57967429 TGAACATCATCATAATACACAGG 0: 1
1: 0
2: 0
3: 13
4: 126
907820899_907820902 12 Left 907820899 1:57967388-57967410 CCCACTATCAAGGCTGTGATGAA 0: 1
1: 0
2: 1
3: 18
4: 150
Right 907820902 1:57967423-57967445 ACACAGGAGTACCTTAACCTAGG 0: 1
1: 0
2: 0
3: 5
4: 114
907820899_907820904 26 Left 907820899 1:57967388-57967410 CCCACTATCAAGGCTGTGATGAA 0: 1
1: 0
2: 1
3: 18
4: 150
Right 907820904 1:57967437-57967459 TAACCTAGGTATACCTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907820899 Original CRISPR TTCATCACAGCCTTGATAGT GGG (reversed) Intronic