ID: 907820900

View in Genome Browser
Species Human (GRCh38)
Location 1:57967389-57967411
Sequence GTTCATCACAGCCTTGATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907820900_907820902 11 Left 907820900 1:57967389-57967411 CCACTATCAAGGCTGTGATGAAC No data
Right 907820902 1:57967423-57967445 ACACAGGAGTACCTTAACCTAGG 0: 1
1: 0
2: 0
3: 5
4: 114
907820900_907820904 25 Left 907820900 1:57967389-57967411 CCACTATCAAGGCTGTGATGAAC No data
Right 907820904 1:57967437-57967459 TAACCTAGGTATACCTGAATTGG No data
907820900_907820901 -5 Left 907820900 1:57967389-57967411 CCACTATCAAGGCTGTGATGAAC No data
Right 907820901 1:57967407-57967429 TGAACATCATCATAATACACAGG 0: 1
1: 0
2: 0
3: 13
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907820900 Original CRISPR GTTCATCACAGCCTTGATAG TGG (reversed) Intronic