ID: 907820901

View in Genome Browser
Species Human (GRCh38)
Location 1:57967407-57967429
Sequence TGAACATCATCATAATACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907820900_907820901 -5 Left 907820900 1:57967389-57967411 CCACTATCAAGGCTGTGATGAAC No data
Right 907820901 1:57967407-57967429 TGAACATCATCATAATACACAGG 0: 1
1: 0
2: 0
3: 13
4: 126
907820899_907820901 -4 Left 907820899 1:57967388-57967410 CCCACTATCAAGGCTGTGATGAA 0: 1
1: 0
2: 1
3: 18
4: 150
Right 907820901 1:57967407-57967429 TGAACATCATCATAATACACAGG 0: 1
1: 0
2: 0
3: 13
4: 126
907820896_907820901 24 Left 907820896 1:57967360-57967382 CCTGTTTGATCCTGAACTGTACT 0: 1
1: 0
2: 0
3: 5
4: 105
Right 907820901 1:57967407-57967429 TGAACATCATCATAATACACAGG 0: 1
1: 0
2: 0
3: 13
4: 126
907820897_907820901 14 Left 907820897 1:57967370-57967392 CCTGAACTGTACTTGCTACCCAC No data
Right 907820901 1:57967407-57967429 TGAACATCATCATAATACACAGG 0: 1
1: 0
2: 0
3: 13
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907820901 Original CRISPR TGAACATCATCATAATACAC AGG Intronic