ID: 907820901

View in Genome Browser
Species Human (GRCh38)
Location 1:57967407-57967429
Sequence TGAACATCATCATAATACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907820896_907820901 24 Left 907820896 1:57967360-57967382 CCTGTTTGATCCTGAACTGTACT 0: 1
1: 0
2: 0
3: 5
4: 105
Right 907820901 1:57967407-57967429 TGAACATCATCATAATACACAGG 0: 1
1: 0
2: 0
3: 13
4: 126
907820900_907820901 -5 Left 907820900 1:57967389-57967411 CCACTATCAAGGCTGTGATGAAC No data
Right 907820901 1:57967407-57967429 TGAACATCATCATAATACACAGG 0: 1
1: 0
2: 0
3: 13
4: 126
907820897_907820901 14 Left 907820897 1:57967370-57967392 CCTGAACTGTACTTGCTACCCAC No data
Right 907820901 1:57967407-57967429 TGAACATCATCATAATACACAGG 0: 1
1: 0
2: 0
3: 13
4: 126
907820899_907820901 -4 Left 907820899 1:57967388-57967410 CCCACTATCAAGGCTGTGATGAA 0: 1
1: 0
2: 1
3: 18
4: 150
Right 907820901 1:57967407-57967429 TGAACATCATCATAATACACAGG 0: 1
1: 0
2: 0
3: 13
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907820901 Original CRISPR TGAACATCATCATAATACAC AGG Intronic
902075853 1:13785069-13785091 TGACAATCATCATATTACCCAGG - Intronic
907820901 1:57967407-57967429 TGAACATCATCATAATACACAGG + Intronic
909863796 1:80639636-80639658 TGAACTTCATAATAATATTCAGG + Intergenic
910741203 1:90519042-90519064 TGAAAATCATCAAAAGACAAAGG + Intergenic
916294160 1:163198421-163198443 TAAATATCATCATAATATAAAGG - Intronic
918632644 1:186736669-186736691 TGTACATTATCTTAATACTCTGG - Intergenic
924559301 1:245144250-245144272 GGAAGATCATCAAAAGACACTGG - Intergenic
924855541 1:247871808-247871830 TGTACTTCACCAAAATACACAGG + Intronic
1068190940 10:53651999-53652021 TGAATATCATCAAAAGACAGAGG + Intergenic
1068385326 10:56318750-56318772 TTAAACTCCTCATAATACACTGG + Intergenic
1072607044 10:96993090-96993112 GGAACATGATCATAAAGCACTGG - Intergenic
1074496132 10:113981570-113981592 TGAACTACATTGTAATACACTGG - Intergenic
1076526285 10:131114435-131114457 TGAAAATCCTCATAAGACACGGG + Intronic
1080262069 11:30360079-30360101 TGCACACCATCCTAATACAAGGG + Intergenic
1085576924 11:77613994-77614016 TGCAGATGATCATAATATACAGG - Intronic
1086429149 11:86718538-86718560 TGAACATGATTAAAATTCACAGG + Intergenic
1088425119 11:109693735-109693757 TGACCATCCTCATCATCCACTGG + Intergenic
1089694438 11:120208439-120208461 TGGACATAATCAAAATACAATGG + Intergenic
1089836009 11:121371315-121371337 TGAACTTCATCATAACATCCTGG + Intergenic
1094508148 12:31079145-31079167 AAAACATAATCATAACACACTGG - Intronic
1096549329 12:52361852-52361874 GCATCATCATCATAACACACAGG + Intronic
1100036628 12:90259734-90259756 TGAAAATGTGCATAATACACTGG - Intergenic
1101182890 12:102238989-102239011 TGAAAATCCTCATAAAATACTGG + Intergenic
1102362217 12:112297816-112297838 TGAGCATCATCAACATATACAGG + Intronic
1105349714 13:19604055-19604077 TGAACGTCAACAGAAAACACTGG - Intergenic
1105650691 13:22373525-22373547 TAAACATTTTCATAATAAACTGG - Intergenic
1105743859 13:23358089-23358111 TTAACATCATCATGATCCAGTGG - Intronic
1107735087 13:43391015-43391037 TGAACAATATCATAAGAAACGGG - Intronic
1109073650 13:57805479-57805501 TCAACATCAGCATTATATACTGG + Intergenic
1112834254 13:103494337-103494359 TGAACATTATTGTAATATACTGG + Intergenic
1112844381 13:103620771-103620793 TGATTATCATCTTAATACAGTGG + Intergenic
1113507382 13:110826577-110826599 TGTCCATCATCATTAGACACTGG - Intergenic
1116367172 14:44082159-44082181 TGAACATCACCAAAATATATTGG + Intergenic
1119709306 14:76809790-76809812 TGAACATCATCATCATCATCAGG + Intronic
1120519876 14:85514077-85514099 TGAACATCAACATAAAAGATTGG + Intergenic
1122121276 14:99554749-99554771 TGAAGCTCATCATCATAAACGGG + Intronic
1124223865 15:27872207-27872229 TGAACAGTATCTTTATACACAGG - Intronic
1125572048 15:40727819-40727841 AGAACATAATCATAGCACACTGG + Intronic
1136586244 16:31187123-31187145 TGACCATCATCATGAGAAACTGG + Intronic
1141321604 16:83015494-83015516 TGAAAATCAACATAATCCAAAGG + Intronic
1150437694 17:65166923-65166945 TGAAAAACATCATAACACTCAGG - Intronic
1150850790 17:68701975-68701997 TAAACATCATAATTATACAGTGG + Intergenic
1157648886 18:49306778-49306800 TGAAAATCATAGTAATTCACAGG - Intronic
1159503984 18:69310677-69310699 TGAACATTATCTTAATACCCTGG - Intergenic
1165895962 19:39141082-39141104 TGAACATTTCCATAATACAAAGG - Intronic
1168545442 19:57245835-57245857 TAAACATCCTTATAATGCACAGG + Intronic
925528431 2:4831639-4831661 TAAACATCCTAAAAATACACAGG + Intergenic
926871358 2:17421458-17421480 TGAACTTCCTTATAATTCACTGG + Intergenic
935895245 2:107730092-107730114 TGAGTAGAATCATAATACACTGG - Intergenic
937636742 2:124164750-124164772 TAAGCATAATCATAAGACACTGG + Intronic
939555667 2:143669915-143669937 TTAACTTCAGCATGATACACTGG - Intronic
942693584 2:178613494-178613516 TGGTCATTATCATAATATACTGG + Intronic
943549946 2:189326222-189326244 TCATCATCATTATAATAAACTGG - Intergenic
943736399 2:191360442-191360464 TGAAAATCACCAAATTACACAGG - Intronic
943867467 2:192945061-192945083 TCAACTTCATCATAATAAATAGG - Intergenic
945606873 2:211944504-211944526 TGAAAATGAAAATAATACACTGG - Intronic
945644476 2:212473100-212473122 TGAACATCATCAGAATTGACAGG - Intronic
946066214 2:216989502-216989524 TGAAAAACATCATTACACACAGG + Intergenic
1170272381 20:14541886-14541908 TGATCATCATAATACTACAGGGG + Intronic
1170797629 20:19563036-19563058 CAAACATCATTATAATAAACTGG + Intronic
1172459410 20:35105285-35105307 AGAACATCATTATAATGCATTGG + Intergenic
1172956821 20:38766043-38766065 TGTACATGTTTATAATACACAGG + Intronic
1177442759 21:21148733-21148755 TGAACATCAACTGAATATACTGG - Intronic
1177982166 21:27927748-27927770 CAAACATCATCATAATAAAAAGG - Intergenic
1179090639 21:38262513-38262535 TCAACAACATCAGAATACAATGG + Intronic
1180650607 22:17373417-17373439 TGAAAATTATCATAAAATACAGG + Intronic
1182011999 22:27008823-27008845 TCATCATCATCATCTTACACAGG + Intergenic
1183447138 22:37865005-37865027 TGAACATCATCACAATCAACAGG - Intronic
952708501 3:36405349-36405371 TGAACACCCTCATAATACAAGGG - Intronic
952718474 3:36507320-36507342 TGAAAATCCTCATAAAATACTGG - Intronic
953510052 3:43526654-43526676 TGAACATATTCATAAGACATAGG - Intronic
960851927 3:122064596-122064618 TGAACCACATCCTTATACACAGG - Intronic
966090040 3:176122872-176122894 TGAACAGCATCATCACAAACTGG - Intergenic
971631686 4:29000415-29000437 TGAACATGATCATTATACATGGG + Intergenic
972264641 4:37447330-37447352 TGAACATCTTAATAAAACACTGG - Exonic
976849664 4:89530582-89530604 TGAACATCAGTGTAAGACACTGG + Intergenic
977935319 4:102795842-102795864 TGAACAAAATCAAAATAAACAGG + Intronic
981422221 4:144564359-144564381 TGAACTTCCTAAAAATACACAGG - Intergenic
981890206 4:149727554-149727576 TGACCATCATTATAAGATACTGG + Intergenic
985002051 4:185495365-185495387 TGAACATCATGAGTATACACTGG + Intergenic
986874221 5:12087227-12087249 TGAAAATCATCACAATATGCGGG + Intergenic
986934757 5:12869129-12869151 GGAACAACTTCATAATCCACTGG + Intergenic
987536457 5:19195499-19195521 TGAATATGATCATAATTCACTGG - Intergenic
990193459 5:53287606-53287628 TGAACATCATGAGGAGACACAGG - Intergenic
992236484 5:74714851-74714873 TGAACTTCATCAGGACACACTGG + Intronic
993423712 5:87735492-87735514 AGAAAATCAACATAATGCACAGG + Intergenic
993445447 5:88006416-88006438 TGAATATAATGATAATACAGAGG - Intergenic
993840808 5:92876365-92876387 TGAACATGATAATAAGACAGTGG + Intergenic
996332034 5:122340874-122340896 TGAAAATCAACTTAATAAACAGG - Intronic
996977712 5:129455271-129455293 GGAAGGTCATCATAATACAAGGG - Intergenic
997565815 5:134885384-134885406 TGAAAAACTTCATAATTCACAGG - Intronic
998421521 5:141991766-141991788 TGAAAAACATCATTAAACACTGG + Intronic
1000802844 5:165750293-165750315 GTAATATGATCATAATACACTGG + Intergenic
1005248283 6:23913942-23913964 TGAAGATCATAATAAAACAAGGG + Intergenic
1007153204 6:39715884-39715906 TGAACACCAACATAACACAGAGG + Intronic
1009586566 6:65614281-65614303 TGTACTTCACCAAAATACACAGG + Intronic
1009631420 6:66205839-66205861 TTAAAATTATCATTATACACTGG + Intergenic
1011138481 6:84126250-84126272 TTAACAAGATCAAAATACACTGG + Intronic
1012106181 6:95162003-95162025 TGAAGAACATTATAATAAACTGG + Intergenic
1012641548 6:101623592-101623614 TGAACAGCATAAAAAAACACAGG + Intronic
1014682336 6:124447219-124447241 TAAACATCATAATATTACAACGG - Intronic
1014929581 6:127319103-127319125 TGAAAATTATAATAGTACACAGG - Intronic
1014943067 6:127465882-127465904 TCAACAACATCAGAATACAGTGG - Intronic
1018292170 6:162302909-162302931 TGAACATTATCATAATGCTAAGG + Intronic
1018579234 6:165293889-165293911 TGCACAGAATAATAATACACAGG - Intronic
1021884241 7:25123271-25123293 TGAACATGAACACAAAACACAGG + Exonic
1022396925 7:29997094-29997116 TCAACAACAGCAGAATACACAGG - Intergenic
1023357625 7:39382880-39382902 TGATCTTCATAATAATACCCTGG + Intronic
1024692073 7:51813967-51813989 TCAACATGATTGTAATACACAGG + Intergenic
1026509263 7:71014780-71014802 TGAACAAAGTCAAAATACACTGG - Intergenic
1028117859 7:87021986-87022008 TGAAAATGATCATATTCCACAGG - Intronic
1028638417 7:93016586-93016608 TGAACATCCTCATGACAAACTGG - Intergenic
1029051321 7:97691672-97691694 TGATCATCATATTAATACAGAGG - Intergenic
1031144303 7:117980762-117980784 TGAGCATCCTCAGTATACACAGG - Intergenic
1031286343 7:119873815-119873837 AGAACATCATTAAAATACAATGG + Intergenic
1038351462 8:26779841-26779863 TGAGCTTCTTAATAATACACGGG + Intronic
1042341282 8:67682787-67682809 AGAAAATCCTCATAATTCACAGG - Intronic
1042513203 8:69632711-69632733 TGTATATTTTCATAATACACAGG - Intronic
1042626657 8:70765525-70765547 CGAACATCATCATAGTAAACAGG - Intronic
1043223157 8:77692203-77692225 TAAACATCAGAATTATACACTGG - Intergenic
1045685018 8:104702856-104702878 TTAACATCATTATATTACAGTGG + Intronic
1046062197 8:109152925-109152947 TGAAGAACATCAGAATAAACAGG + Intergenic
1046444914 8:114305783-114305805 TATACATCATCACAATAAACTGG - Intergenic
1047333829 8:123917813-123917835 CGAACATTATCAACATACACAGG + Intronic
1047640234 8:126811332-126811354 TGAAAACCCTCATAATACATAGG - Intergenic
1048641243 8:136364496-136364518 GGAACACCATCATAATAAATAGG - Intergenic
1050017149 9:1246045-1246067 TAAACATCAAAATAATAAACAGG + Intergenic
1052146498 9:25056522-25056544 TGAAAATCATCTGAATACACAGG + Intergenic
1052748053 9:32460750-32460772 TGAACAACAAAAAAATACACTGG + Intronic
1055628259 9:78196156-78196178 TGAACATCATGATTGTGCACAGG - Intergenic
1056603206 9:88062890-88062912 TGCACAGCAGCATAATATACAGG - Intergenic
1059061141 9:111036930-111036952 TAAACATCATTAAAATACACAGG - Intronic
1062743891 9:138198808-138198830 TGAACAACTTAATAACACACAGG + Intergenic
1187737403 X:22318982-22319004 TGAACACTATCATAGCACACTGG + Intergenic
1192316689 X:70057732-70057754 TGAACAACATCATGAACCACTGG + Intergenic
1192988210 X:76423230-76423252 AGAACAACATCATCATAAACAGG + Intergenic
1196088659 X:111714621-111714643 TGAACATCATAATAAAACGTTGG - Intronic
1196551522 X:117032213-117032235 TGAACACTATCATAAAACACAGG + Intergenic
1197611164 X:128639860-128639882 TGAAAATAATCATAAGTCACTGG + Intergenic
1201892297 Y:18955807-18955829 TGGACTTCAACAGAATACACTGG - Intergenic