ID: 907820902

View in Genome Browser
Species Human (GRCh38)
Location 1:57967423-57967445
Sequence ACACAGGAGTACCTTAACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907820899_907820902 12 Left 907820899 1:57967388-57967410 CCCACTATCAAGGCTGTGATGAA 0: 1
1: 0
2: 1
3: 18
4: 150
Right 907820902 1:57967423-57967445 ACACAGGAGTACCTTAACCTAGG 0: 1
1: 0
2: 0
3: 5
4: 114
907820900_907820902 11 Left 907820900 1:57967389-57967411 CCACTATCAAGGCTGTGATGAAC No data
Right 907820902 1:57967423-57967445 ACACAGGAGTACCTTAACCTAGG 0: 1
1: 0
2: 0
3: 5
4: 114
907820897_907820902 30 Left 907820897 1:57967370-57967392 CCTGAACTGTACTTGCTACCCAC No data
Right 907820902 1:57967423-57967445 ACACAGGAGTACCTTAACCTAGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907820902 Original CRISPR ACACAGGAGTACCTTAACCT AGG Intronic