ID: 907820902

View in Genome Browser
Species Human (GRCh38)
Location 1:57967423-57967445
Sequence ACACAGGAGTACCTTAACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907820899_907820902 12 Left 907820899 1:57967388-57967410 CCCACTATCAAGGCTGTGATGAA 0: 1
1: 0
2: 1
3: 18
4: 150
Right 907820902 1:57967423-57967445 ACACAGGAGTACCTTAACCTAGG 0: 1
1: 0
2: 0
3: 5
4: 114
907820897_907820902 30 Left 907820897 1:57967370-57967392 CCTGAACTGTACTTGCTACCCAC No data
Right 907820902 1:57967423-57967445 ACACAGGAGTACCTTAACCTAGG 0: 1
1: 0
2: 0
3: 5
4: 114
907820900_907820902 11 Left 907820900 1:57967389-57967411 CCACTATCAAGGCTGTGATGAAC No data
Right 907820902 1:57967423-57967445 ACACAGGAGTACCTTAACCTAGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907820902 Original CRISPR ACACAGGAGTACCTTAACCT AGG Intronic
902121363 1:14168818-14168840 AGCCAGTAGTACCTAAACCTGGG + Intergenic
903917671 1:26776058-26776080 ACTCAGGAGTTCATGAACCTCGG - Intronic
904887458 1:33751712-33751734 ACACAGGAGTGCATGAACCCAGG - Intronic
907820902 1:57967423-57967445 ACACAGGAGTACCTTAACCTAGG + Intronic
912587999 1:110784290-110784312 ACACGAGAATAGCTTAACCTGGG + Intergenic
916678893 1:167086800-167086822 ACTCAGGAGAACTTTAACCTGGG - Intronic
918021058 1:180690881-180690903 AAAAAGGAGTAAATTAACCTAGG + Intronic
919604340 1:199662702-199662724 ACCCAGGAGAAGCTTAACTTCGG - Intergenic
923640237 1:235750425-235750447 ACACAGAAGTAGCTTAACACGGG + Intronic
1064292965 10:14052354-14052376 ATAAAGGAGTACCTGAAGCTGGG + Intronic
1068753232 10:60620542-60620564 ACTCTGGAGTCCCTCAACCTGGG - Intronic
1069188211 10:65453630-65453652 ACCCAGCAGCACCTTGACCTTGG + Intergenic
1090224471 11:125061900-125061922 TTAAAGGAGTACCTTAACCTGGG + Intergenic
1091355353 11:134933575-134933597 ACAAAGAAGTACCTGAAACTGGG - Intergenic
1091960842 12:4692835-4692857 ATAAAGGAGTACCTGAAGCTGGG + Exonic
1092602169 12:10079054-10079076 ATAAAGGAGTACCTGAGCCTGGG - Intronic
1093805089 12:23422457-23422479 ACAGAAGAGTAGCTTAACATGGG - Intergenic
1094761990 12:33544672-33544694 ACAAAGAAGTACCTAAATCTGGG + Intergenic
1099199021 12:79653984-79654006 ACACAGTAGTACCTCCAACTGGG - Intronic
1100022408 12:90085729-90085751 ACACAGAAGTACACTATCCTAGG - Intergenic
1101505960 12:105346310-105346332 TCACAGGCATTCCTTAACCTTGG + Intronic
1104171596 12:126286885-126286907 ACAAAGGAATACCTGAAGCTAGG + Intergenic
1106310916 13:28553527-28553549 ACCCAGGAGAACCTGAAGCTCGG + Intergenic
1106931243 13:34668109-34668131 ACACAGGACTACCTGAAGCCTGG + Intergenic
1107735435 13:43394270-43394292 ATACAGGAGCAGCCTAACCTTGG - Intronic
1109973148 13:69796610-69796632 ATAAAGGAATACCTGAACCTGGG - Intronic
1110725720 13:78820787-78820809 ATACAGGAGTGCATTATCCTTGG - Intergenic
1110737810 13:78958554-78958576 ACACAACAGCACCTTAACTTGGG - Intergenic
1110753651 13:79145781-79145803 ACACAGGACTACCAGAATCTTGG + Intergenic
1112597246 13:100818747-100818769 CCACAGGAGGACCCTAACCTTGG + Intergenic
1112892604 13:104256828-104256850 ACACAGGAGAACCTTGTTCTTGG - Intergenic
1113165130 13:107431999-107432021 ATAAAGGAGTACCTGAAACTGGG + Intronic
1113325216 13:109275083-109275105 GCACAGGACTACCTGAACCACGG + Intergenic
1116627535 14:47284761-47284783 CCACAGGAGAGCATTAACCTTGG - Intronic
1121002686 14:90463712-90463734 TCACAGGAATACCTCCACCTAGG - Intergenic
1202850191 14_GL000225v1_random:11809-11831 ACACAAGAGTAACATCACCTGGG + Intergenic
1202853300 14_GL000225v1_random:35385-35407 ACACAAGAGTTCCATCACCTGGG + Intergenic
1202855418 14_GL000225v1_random:47831-47853 AGACAGGAGTTACTTCACCTGGG + Intergenic
1127091695 15:55473431-55473453 AAATAGGGGTAACTTAACCTAGG + Intronic
1127091701 15:55473484-55473506 AAATAGGGGTAACTTAACCTAGG + Intronic
1129462530 15:75706785-75706807 ACACAGGATCACCTTGACCAGGG + Intronic
1130043216 15:80423368-80423390 ACACAGGAATTCCTAACCCTAGG + Intronic
1135861755 16:26062509-26062531 AGACAGTTGTACCTGAACCTTGG + Intronic
1148872875 17:50668869-50668891 ACACAGTGGCACCTTCACCTGGG + Exonic
1150918692 17:69461258-69461280 ACCCAGGAGTACATAAACCAGGG - Intronic
1151178895 17:72311562-72311584 AAACAGCAGTACCATAAACTGGG - Intergenic
1156188896 18:34696156-34696178 AGACAGGGGTATCTTATCCTGGG - Intronic
1158238662 18:55350857-55350879 ACAAAGGAATACCTTACCCATGG + Exonic
1158799946 18:60894398-60894420 AGACAGGTGCTCCTTAACCTCGG - Intergenic
1159734420 18:72076315-72076337 ACACTGAACTACCTGAACCTGGG + Intergenic
1159803592 18:72928329-72928351 ACACAATAGTTCCTAAACCTTGG + Intergenic
1160590628 18:79942904-79942926 ACTCAGGGGTACCTTAGCCAGGG - Intronic
1166682308 19:44776663-44776685 ACTCAGGAGTATCTTAACTCTGG + Intergenic
1167037517 19:47002935-47002957 TCACAGAAGTACCTGAAACTAGG + Exonic
1167669302 19:50840482-50840504 ACACAGAAGTGCTTGAACCTGGG + Intergenic
1167836701 19:52078192-52078214 ACACAGAATTACTTGAACCTGGG + Intronic
926142508 2:10376227-10376249 ACAAAGGAGTACCTGAGACTGGG - Intronic
929840700 2:45459776-45459798 ACACATGAGTAGCTAAACCAAGG + Intronic
930483046 2:51973504-51973526 ACAAAGAAGTACCTGAAACTGGG + Intergenic
931160009 2:59678923-59678945 ATACAAGAAAACCTTAACCTCGG + Intergenic
932109870 2:68988220-68988242 CCACAAGAGTACCTTTACTTTGG - Intergenic
933895039 2:86803299-86803321 ACACAGGAGTACAGATACCTTGG - Intronic
942825151 2:180167009-180167031 ACAAAGGAGTATCCTGACCTGGG - Intergenic
945985743 2:216352232-216352254 ACACAGGAGTACCTCCATTTGGG - Intronic
946645676 2:221831338-221831360 ACAAAGGAGTACCTGAGGCTGGG + Intergenic
1170120345 20:12904831-12904853 ACACATCTGTACATTAACCTAGG - Intergenic
1171423776 20:25036618-25036640 ACACAGGACTTACTTATCCTGGG - Intronic
1171951382 20:31425534-31425556 AGACTGGAGTACCTTTATCTGGG - Intergenic
1172273962 20:33669837-33669859 CCACAGGAGCAACTTAATCTGGG - Intronic
1177197358 21:17917474-17917496 ACACAGCAGTAAAATAACCTGGG + Intronic
1177829128 21:26117229-26117251 ATACTGGATTCCCTTAACCTGGG + Intronic
1179185461 21:39082398-39082420 ACACAGGAGACCCCTAACCAAGG + Intergenic
949371493 3:3339442-3339464 ACACAGTAGTCCCTTATCCCTGG - Intergenic
949510471 3:4762517-4762539 TCACAGGATCACCTTCACCTTGG + Intronic
949727189 3:7062876-7062898 TCAGAGGAGTAGCTTATCCTTGG + Intronic
949740078 3:7222283-7222305 TCACAGCACTACCTTAATCTAGG - Intronic
950023538 3:9805805-9805827 ACACAAAAGTACCAGAACCTGGG + Intronic
956376469 3:68618520-68618542 CCTCAGAGGTACCTTAACCTTGG + Intergenic
956796225 3:72721082-72721104 TCACAGAAGAACCTTAACATTGG + Intergenic
956994446 3:74808272-74808294 ACACATGGGTACATTAAACTTGG - Intergenic
960698237 3:120416230-120416252 ACTCAGAAGTACCTGAACCTGGG - Intronic
962848114 3:139288562-139288584 GCAGAGGAGCACCTTACCCTCGG + Intronic
962856799 3:139354084-139354106 CCACAGGAGGGCCTTTACCTAGG - Intronic
963490135 3:145989282-145989304 AGAAAGGAGTACCTGAAGCTGGG - Intergenic
971091275 4:23348484-23348506 ACTCAGGTGTAACTTAATCTAGG + Intergenic
974684917 4:65215426-65215448 ACCCATGAGTCCCCTAACCTTGG + Intergenic
975722946 4:77265887-77265909 ACCCATGAGTCCATTAACCTTGG + Intronic
976212985 4:82690972-82690994 ACAAAGGAGGACCTTAATATAGG + Intronic
979675853 4:123409703-123409725 ACAAAGGGGAACTTTAACCTTGG + Intergenic
981499597 4:145435829-145435851 ACACAGGTGTTTCTTAACCCAGG - Intergenic
984677869 4:182570735-182570757 AGGCAGGAGAACGTTAACCTGGG + Intronic
987225464 5:15835948-15835970 ACACAGGAGTACCTCCAGCCTGG + Intronic
991294081 5:65062464-65062486 ACAGAGGAGTCCCTGAAGCTAGG - Intergenic
992377883 5:76207198-76207220 ACACCGAAGTACCTTTATCTTGG + Intronic
992765806 5:79998462-79998484 ACAAAGGAATACCTGAAACTGGG - Intronic
996000621 5:118358571-118358593 CCACAGGAGTACTTTAAAATGGG - Intergenic
998677053 5:144421319-144421341 ACACAGGGGAACCTTAATATAGG - Intronic
1004169918 6:13287881-13287903 GCACAGGAGTACCTTAGCAATGG - Exonic
1005268528 6:24138685-24138707 AGATAGGAGGAACTTAACCTGGG - Intronic
1005567243 6:27108535-27108557 ACAAGGGAGGTCCTTAACCTGGG + Intergenic
1010634159 6:78235985-78236007 ACACAGGAGTTCATTAGCTTGGG + Intergenic
1019772899 7:2894932-2894954 GCACAGGAGCACCCCAACCTGGG - Intergenic
1019911569 7:4103439-4103461 AGACAGGAGTTCTTTAACCCTGG - Intronic
1021787523 7:24166137-24166159 ACACAGAGGCTCCTTAACCTTGG + Intergenic
1023762023 7:43473319-43473341 ACACAGGAATACCTGAAACCAGG - Intronic
1027689426 7:81324186-81324208 ACACAGGAGTAGGTAATCCTTGG + Intergenic
1029016049 7:97316365-97316387 ACACAGGAGGCCCATAGCCTGGG - Intergenic
1037352558 8:17976798-17976820 ACACATTAGTACCTTAACTTTGG + Intronic
1037361745 8:18081613-18081635 ACTCAGGAGGACCTTCACATAGG + Intronic
1037825691 8:22159439-22159461 ACACAGAAGGACCTTTAGCTGGG - Intronic
1041933174 8:63309251-63309273 ATAAAGGAGTACCTGAAGCTGGG - Intergenic
1044178600 8:89160976-89160998 ACACAGGAGCAGCTGAAGCTGGG - Intergenic
1046314492 8:112480791-112480813 ATAAAGGAGTACCTGAAACTGGG - Intronic
1051746958 9:20304163-20304185 ACACAGGATTGCCTCAAGCTGGG + Intergenic
1055663984 9:78535018-78535040 ACCCATGAGTTCCTTAACCCAGG - Intergenic
1056513806 9:87331198-87331220 AGACAGGAGCATCTAAACCTTGG - Intergenic
1062375477 9:136260015-136260037 ACACAGGCCTACCTGACCCTGGG + Intergenic
1186071413 X:5825515-5825537 GCACAAGAGCACCTTACCCTTGG - Intergenic
1187972044 X:24668553-24668575 CCACAGGAGTACCTTTTCCAGGG + Intronic
1193184151 X:78492504-78492526 AGACAGTAGTCCCTTATCCTAGG + Intergenic