ID: 907822657

View in Genome Browser
Species Human (GRCh38)
Location 1:57986261-57986283
Sequence ATTGGAGGAGGTGGGGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907822649_907822657 -7 Left 907822649 1:57986245-57986267 CCCCTGAGGTGATGGTATTGGAG 0: 1
1: 0
2: 7
3: 43
4: 300
Right 907822657 1:57986261-57986283 ATTGGAGGAGGTGGGGCCTTTGG No data
907822650_907822657 -8 Left 907822650 1:57986246-57986268 CCCTGAGGTGATGGTATTGGAGG No data
Right 907822657 1:57986261-57986283 ATTGGAGGAGGTGGGGCCTTTGG No data
907822652_907822657 -9 Left 907822652 1:57986247-57986269 CCTGAGGTGATGGTATTGGAGGA No data
Right 907822657 1:57986261-57986283 ATTGGAGGAGGTGGGGCCTTTGG No data
907822647_907822657 -2 Left 907822647 1:57986240-57986262 CCTAACCCCTGAGGTGATGGTAT 0: 3
1: 33
2: 187
3: 645
4: 1444
Right 907822657 1:57986261-57986283 ATTGGAGGAGGTGGGGCCTTTGG No data
907822644_907822657 22 Left 907822644 1:57986216-57986238 CCTGCAAAATTCATATATTGAAA No data
Right 907822657 1:57986261-57986283 ATTGGAGGAGGTGGGGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907822657 Original CRISPR ATTGGAGGAGGTGGGGCCTT TGG Intronic