ID: 907825912

View in Genome Browser
Species Human (GRCh38)
Location 1:58016741-58016763
Sequence AGCTTATTACAGATGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907825912_907825914 -6 Left 907825912 1:58016741-58016763 CCATTCTCCATCTGTAATAAGCT 0: 1
1: 0
2: 1
3: 27
4: 219
Right 907825914 1:58016758-58016780 TAAGCTATGTACTATGTACCAGG 0: 1
1: 0
2: 0
3: 11
4: 143
907825912_907825915 1 Left 907825912 1:58016741-58016763 CCATTCTCCATCTGTAATAAGCT 0: 1
1: 0
2: 1
3: 27
4: 219
Right 907825915 1:58016765-58016787 TGTACTATGTACCAGGTGCAAGG 0: 1
1: 0
2: 5
3: 26
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907825912 Original CRISPR AGCTTATTACAGATGGAGAA TGG (reversed) Intronic
904071604 1:27803062-27803084 AGATTATGAAAAATGGAGAATGG + Intronic
904511830 1:31017311-31017333 AACCTACTACAGATGAAGAAAGG + Intronic
904955261 1:34278365-34278387 AGCAAATTCCAGATGGAGCAAGG - Intergenic
907492459 1:54816882-54816904 AACTCATAACAGATGGAGTAGGG + Intronic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
909222189 1:72979413-72979435 AGCTGAATAGAAATGGAGAAAGG + Intergenic
910456504 1:87403242-87403264 AGCTTTATACAAATGTAGAAAGG + Intergenic
911637654 1:100253116-100253138 AGCTTGTTAGAAATGCAGAATGG - Intergenic
916587468 1:166161026-166161048 AGCACATTTCAGATGGAGAGCGG + Intronic
916948283 1:169752610-169752632 AACTTATTACAAGTGGAAAATGG + Intronic
919208018 1:194442422-194442444 AGTTTATTATAGATGCAGAGTGG + Intergenic
919220356 1:194620611-194620633 AGCATATTACAGAAGTAGCAAGG + Intergenic
920249922 1:204616821-204616843 TGCTTATCAGAGAAGGAGAAGGG + Intergenic
923225985 1:231939416-231939438 AGTTCATTACAGATGGAGAAAGG - Intronic
924134271 1:240947239-240947261 AGCTTATTACATAATGAAAATGG - Intronic
1063378512 10:5569424-5569446 ACTTTATGACAGATGGAGAAGGG - Intergenic
1063521825 10:6748277-6748299 GGCTTATTGAAGATGGAGATTGG + Intergenic
1064753429 10:18554638-18554660 AGAATGTAACAGATGGAGAATGG + Intronic
1064754823 10:18564346-18564368 AGAATGTAACAGATGGAGAATGG - Intronic
1066510030 10:36084893-36084915 AGCTTAACACAGATAGAGATGGG - Intergenic
1066621582 10:37358589-37358611 ATCTTATTACAAATGGATATTGG - Intronic
1071938346 10:90556621-90556643 AGCTGACTGAAGATGGAGAAAGG - Intergenic
1073001012 10:100286322-100286344 AAATTATGGCAGATGGAGAATGG - Intronic
1075605430 10:123802027-123802049 AGCATCTCACAGATGGAGGAAGG + Intronic
1076862720 10:133148030-133148052 AGCTAATTACAGATGATAAAGGG + Intergenic
1078422092 11:11220890-11220912 AGCGAATTACAAATGGAGATTGG - Intergenic
1079418174 11:20260206-20260228 AGTTGATTAGACATGGAGAAGGG + Intergenic
1080275802 11:30502296-30502318 AGGTTACTATAGATGGATAATGG - Intronic
1080793814 11:35544644-35544666 AGATTAATACACATGGATAAGGG + Intergenic
1081047380 11:38293342-38293364 TGCATATTATAGATGGAGAGAGG + Intergenic
1081372582 11:42322142-42322164 AGCTGATCACAGAAGGAGCAGGG + Intergenic
1081755630 11:45542293-45542315 AGCTTATTACAGATAAAGGGTGG + Intergenic
1089590561 11:119537715-119537737 AGCTGACTATTGATGGAGAAGGG + Intergenic
1090397916 11:126431548-126431570 AGCTGATGACGGATGGGGAATGG + Intronic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1093887943 12:24485032-24485054 AGGTTCGGACAGATGGAGAAAGG + Intergenic
1095240642 12:39854777-39854799 AGCTTGATACTGCTGGAGAAAGG - Intronic
1098681633 12:73363352-73363374 AGCTTAATACATATGAAAAAAGG + Intergenic
1099782315 12:87212346-87212368 AGCTGGATACAGATGGAGTAGGG - Intergenic
1099841062 12:87967956-87967978 AGAGTATTTCAGATGGAGAATGG - Intergenic
1100096833 12:91049933-91049955 AACTTATTTGAGATTGAGAAAGG - Intergenic
1100152280 12:91753269-91753291 AACTTATTAAAAATGGACAAAGG - Intergenic
1102130678 12:110526316-110526338 AGATTACTAGACATGGAGAAGGG + Intronic
1102331642 12:112037551-112037573 TACTTATTACAGAGGGAAAAAGG + Intronic
1103243587 12:119435839-119435861 AGCTGATTACAGGTGCACAAGGG - Intronic
1107293290 13:38881708-38881730 ACATTGTTACAGATGGTGAAGGG + Exonic
1108771827 13:53711858-53711880 AGCTTGTTACAAATGCAGAATGG + Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1112605733 13:100904148-100904170 ACCTTATCCCAGATGGAGGAGGG - Intergenic
1112857999 13:103794385-103794407 TGCTTCTAACAGATGGAGCAGGG - Intergenic
1112927378 13:104693320-104693342 TGCTGTTGACAGATGGAGAATGG - Intergenic
1115355762 14:32445163-32445185 GGCTTGTTACAGATGCAGGAAGG - Intronic
1115960403 14:38830126-38830148 TGCTTACTACAGAGGGTGAAGGG + Intergenic
1117719566 14:58616121-58616143 AGCTTATTGCAAGGGGAGAATGG + Intergenic
1118669697 14:68110408-68110430 ATCTTGAGACAGATGGAGAAAGG - Intronic
1119009247 14:70966657-70966679 AGATTGTTAAAGAAGGAGAAAGG + Intronic
1119654943 14:76410553-76410575 CCCATTTTACAGATGGAGAATGG + Intronic
1121972790 14:98374111-98374133 TGCTTTATACAGATGAAGAAGGG - Intergenic
1122673588 14:103391138-103391160 TGGTTATCACAGCTGGAGAAAGG + Intronic
1123879208 15:24659216-24659238 AAGTTATCACAGATGAAGAAGGG - Intergenic
1124376261 15:29130929-29130951 AGCTCCTTACAGAAGGAGAGCGG + Intronic
1125416614 15:39460503-39460525 TGCTTTTTAGAGATGGACAAAGG - Intergenic
1125739436 15:41951931-41951953 ATCTTATTACTGATGGTGATAGG - Intronic
1129754107 15:78085594-78085616 TGCTCATGACAGCTGGAGAAGGG - Intronic
1131768320 15:95705476-95705498 AACTTATTCCAGCTGGAGGAAGG - Intergenic
1132374167 15:101317720-101317742 GGCTTATTTCAGATGGGGAAAGG - Intronic
1135708792 16:24697737-24697759 AGCTTATTAGAAATGCAGACTGG + Intergenic
1137745712 16:50818693-50818715 AGCTTATTCCAGATACAGCAAGG + Intergenic
1138219778 16:55240745-55240767 GGCTCATTTCAGATGAAGAATGG - Intergenic
1140665412 16:77222937-77222959 ATCTTATTGCAGGTGGAAAATGG + Intergenic
1140972222 16:80024408-80024430 AACATTTTACAGATGGATAAAGG + Intergenic
1144225408 17:13140117-13140139 ACCTTGTTACAAATGGAGCAAGG + Intergenic
1144481192 17:15630349-15630371 ATATTATTACAAATGGAGAGGGG - Intronic
1147049228 17:37778631-37778653 AGCTTGTTAGAAATGCAGAACGG + Intergenic
1148867409 17:50635634-50635656 CCCTTCTCACAGATGGAGAAAGG + Intronic
1149337551 17:55651956-55651978 AGGTTCTGACAGATTGAGAAAGG + Intergenic
1149414758 17:56447635-56447657 AGCTGATTACCTATGAAGAAAGG - Intronic
1150826950 17:68485214-68485236 AGCTCAAGACAGATGGAGAGTGG + Intergenic
1152191583 17:78891543-78891565 AGCTGATTCCAGCTGCAGAAGGG - Exonic
1156771947 18:40738637-40738659 AGCTACATACTGATGGAGAAAGG + Intergenic
1157812789 18:50709563-50709585 AGCTCATTCAAGATGGAGATTGG + Intronic
1159818526 18:73109484-73109506 AGGTTATTAGGGATAGAGAAGGG - Intergenic
1159983951 18:74820035-74820057 AGAGTATTACAGAAGAAGAAAGG + Intronic
1162986971 19:14277212-14277234 AGCTTATGTCAGGGGGAGAAAGG - Intergenic
1163055065 19:14711864-14711886 AGCTGGTTACAGATGGGTAAGGG + Intronic
1165202636 19:34157771-34157793 AACTTAGTACACAAGGAGAAAGG + Intergenic
1165203946 19:34168060-34168082 AAATTGTTACAGATGGAAAAAGG - Intergenic
1166165016 19:40981315-40981337 AGGTGGTTTCAGATGGAGAAGGG - Intergenic
1166868385 19:45854830-45854852 AGCATATCCCAGATGGAGAGAGG - Intronic
925071203 2:968323-968345 AGAGTATTACAAATGGAAAAGGG - Intronic
925124193 2:1442209-1442231 AGACTAATACAGATGGAGTAGGG + Intronic
925900171 2:8503585-8503607 GCCTTATTACAGATGGAAATGGG - Intergenic
926660839 2:15464380-15464402 ATCTTATTACAGATGCAGGTAGG - Intronic
928953465 2:36836412-36836434 AGCTTATTACAAATAAAGAGAGG - Intergenic
929012410 2:37458088-37458110 ATGTCATTACACATGGAGAAAGG - Intergenic
930526094 2:52531354-52531376 TGGTTATTGCTGATGGAGAAGGG + Intergenic
931999577 2:67872276-67872298 AACTGTTGACAGATGGAGAATGG + Intergenic
932760396 2:74435943-74435965 GGCTTATTACAGAAGGAAAACGG - Intronic
933205350 2:79501175-79501197 ACCTTATTACCCATGGAAAATGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937103162 2:119287085-119287107 TGCATCTTACAGATGGGGAAGGG - Intergenic
937499920 2:122467184-122467206 AGCTTATTACATATAGAGAGAGG + Intergenic
937554962 2:123142711-123142733 AGCTTATTCCTTATGGAAAATGG + Intergenic
938368262 2:130752667-130752689 ATCTAATTAAAAATGGAGAAAGG + Intergenic
939179097 2:138783214-138783236 TGTTTAGTACAGCTGGAGAAAGG + Intergenic
939524827 2:143279879-143279901 AGCTCATTACAGATAGAGATGGG + Intronic
940700340 2:157033233-157033255 TGCTCATTAAAGATGGAGCAAGG + Intergenic
940778230 2:157906354-157906376 AGGATATTACAAATGGAGGATGG + Intronic
941689853 2:168489276-168489298 ACATTATTACAGAGGAAGAATGG - Intronic
942438644 2:176008214-176008236 ATGTTCTTACATATGGAGAAAGG + Intergenic
945888376 2:215401414-215401436 ATCTTATTATAAATGTAGAAAGG + Intronic
946208450 2:218128202-218128224 GGCTTATTACATATGGAGAGAGG - Intronic
948312007 2:236994245-236994267 AGCTTATTCCAGTTGGGGACTGG - Intergenic
1169826038 20:9769815-9769837 AGGTCATATCAGATGGAGAATGG - Intronic
1170035844 20:11988837-11988859 AGCTGTTTACTGTTGGAGAATGG + Intergenic
1171095258 20:22326749-22326771 GGCTTATCAAAGATGGAGACTGG + Intergenic
1171100877 20:22382937-22382959 AGCTTCTTACAGATTTAAAACGG - Intergenic
1171488208 20:25498687-25498709 AGATTATTTCAGAGGGAAAAGGG - Intronic
1175157639 20:56982682-56982704 AGGTTCTTACTGATGGGGAATGG + Intergenic
1175358186 20:58385662-58385684 AGGTTAATAGACATGGAGAAGGG + Intergenic
1179625245 21:42645597-42645619 AGCTTTGTACAGAAGGAGCAAGG + Intergenic
1182441758 22:30368721-30368743 AGCTTTTTGCAGATGCAGGAGGG - Intronic
1183072116 22:35403403-35403425 AGCTTCCTCCAGCTGGAGAAAGG - Exonic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
951159610 3:19401393-19401415 AGTTTATTTCTGATGGACAAAGG + Intronic
951284103 3:20788373-20788395 AGGTTAATACATATGGTGAATGG + Intergenic
951546328 3:23829674-23829696 AGCTAATAAGAGAAGGAGAAAGG + Intronic
951937818 3:28041547-28041569 ATCTTATTACAGGTGGAAAATGG - Intergenic
953222586 3:40986218-40986240 AGCAAATTCCAGATGCAGAAGGG - Intergenic
953254092 3:41272709-41272731 AGCTAATGAAAGAGGGAGAATGG - Intronic
955431429 3:58849169-58849191 ACCTTCTTCCAGTTGGAGAAAGG + Intronic
956264385 3:67380660-67380682 AACTTGTTACAGAAGGGGAAAGG + Intronic
956584445 3:70849521-70849543 AGCTGATGAGAGATGAAGAAAGG - Intergenic
957446019 3:80313858-80313880 AGATTAAAAAAGATGGAGAAGGG + Intergenic
958692744 3:97488932-97488954 ATCATAATATAGATGGAGAATGG - Intronic
959219165 3:103493846-103493868 ACCCTTTTACAGATGGAGAGTGG - Intergenic
960229410 3:115207842-115207864 ACCTTAGTACAGATAGAGATGGG + Intergenic
961207941 3:125102215-125102237 AGAGTTTTCCAGATGGAGAAGGG + Intronic
963018433 3:140848437-140848459 GGATTATTACAGATGGATAAGGG - Intergenic
963284722 3:143422887-143422909 AGCTATTTACAGATGAAAAATGG + Intronic
963286346 3:143438048-143438070 AGCATAATGCAGATGCAGAAAGG + Intronic
965625551 3:170680964-170680986 AGCTTATCTCAGATTTAGAAAGG - Intronic
967496388 3:190147737-190147759 AGCATCTTTAAGATGGAGAACGG - Intergenic
967736617 3:192959766-192959788 AGACTAATACAGATGGAGTAGGG - Intergenic
971103564 4:23497089-23497111 AGGTACTTACAGATGAAGAAGGG + Intergenic
973135750 4:46704402-46704424 AATTCATTGCAGATGGAGAAGGG + Intergenic
973201931 4:47513576-47513598 AGCATATTTCAGATGGAGGAAGG + Intronic
974715470 4:65664697-65664719 AGTATATTTCAGGTGGAGAATGG - Intronic
976583093 4:86763016-86763038 TGGATATTACAGATGGGGAAGGG - Exonic
976652889 4:87454974-87454996 CTGTTATTACAGAAGGAGAAAGG + Intronic
976844599 4:89473686-89473708 AGCTTATTGCAGAAGCAGAGGGG - Intergenic
977730704 4:100348141-100348163 TGCTTATTAGAGCTGGAGTATGG + Intergenic
980068894 4:128221600-128221622 ATCTTAAAACACATGGAGAAAGG - Intronic
980317577 4:131222475-131222497 AGTTTCTCACTGATGGAGAAAGG + Intergenic
981123202 4:141076227-141076249 AGCAAATGACAAATGGAGAAGGG - Intronic
981522838 4:145681692-145681714 ATCTTATTGCAGAGGGTGAAAGG + Intronic
982266924 4:153546233-153546255 ATTATCTTACAGATGGAGAAGGG + Intronic
983008010 4:162509309-162509331 ATCTTATTACAGATGCAGGTAGG + Intergenic
983929109 4:173433994-173434016 AGTTTATTACAGATGTTGAAAGG - Intergenic
984190207 4:176596510-176596532 AGTTTCTTACACAAGGAGAAGGG - Intergenic
987169205 5:15236188-15236210 AGCTGAAAATAGATGGAGAATGG - Intergenic
987867698 5:23567044-23567066 AGCTTACTACAGATACAGATAGG - Intergenic
988012602 5:25509237-25509259 TGCTTATCACAAATGTAGAATGG + Intergenic
989217922 5:38924191-38924213 TGCCTTTTACAGATGAAGAATGG - Intronic
989619885 5:43373689-43373711 AGATTATAAAAGATGAAGAAAGG - Intergenic
992039124 5:72811513-72811535 ACCTAATTAAAAATGGAGAAAGG - Intergenic
995083220 5:108078302-108078324 AGGTTGTTAGAGATGGACAAAGG - Intronic
995366403 5:111366500-111366522 TGGTAATTACAAATGGAGAAAGG - Intronic
995899205 5:117048849-117048871 AGCATCTTTAAGATGGAGAATGG + Intergenic
996031107 5:118704577-118704599 AGATTATTAAACAAGGAGAAGGG + Intergenic
1000997834 5:167976569-167976591 ATCTTATGACAGAAGTAGAAAGG + Intronic
1001019902 5:168173986-168174008 AGCCTAGTCCACATGGAGAATGG + Intronic
1004285852 6:14320024-14320046 ATCTTTTTACAAATGGAGCAAGG - Intergenic
1004607503 6:17207534-17207556 AGCTGATGACAGATGGAGCAAGG + Intergenic
1007172673 6:39875211-39875233 AGCTTACCATAGGTGGAGAAGGG + Intronic
1009405725 6:63310087-63310109 AGTTTTGTACAGATGGAGATAGG - Intronic
1009564188 6:65290215-65290237 AGTTTAGTAAAGATGGAGAAAGG + Intronic
1009757846 6:67963232-67963254 AGCTTATTAGAAATGCACAAGGG + Intergenic
1009828073 6:68893158-68893180 AGTTTATTAGAGAAAGAGAAAGG + Intronic
1010266526 6:73874225-73874247 ACCTGATGACAGAAGGAGAAAGG - Intergenic
1010517581 6:76791483-76791505 AGCTTATGACAGCTAGAAAAAGG - Intergenic
1010819347 6:80395391-80395413 AGGTGATGTCAGATGGAGAAGGG + Intergenic
1011012873 6:82721788-82721810 AGCTCAGTACAGTTGGAGCAGGG - Intergenic
1011022398 6:82829042-82829064 AGCTTATGAGAGAAGGAGAAGGG - Intergenic
1013337087 6:109174525-109174547 AGCATATTTCTGAGGGAGAAAGG + Intergenic
1014080122 6:117276194-117276216 TGCTTTTTCCAGATGCAGAAGGG - Intergenic
1015291871 6:131546693-131546715 AAGTTATTACAAATGAAGAAAGG - Intergenic
1018109557 6:160521989-160522011 AGCTGAGTGCAGATGCAGAAGGG - Intergenic
1018860996 6:167710478-167710500 AGCTTATCACAGAGAGAGCACGG + Intergenic
1019119548 6:169792352-169792374 AGCTCACAACAGATTGAGAAGGG + Intergenic
1021049841 7:15969565-15969587 AGGTTATGAAAGAAGGAGAAAGG + Intergenic
1022165422 7:27755293-27755315 AGCTGATTACATATGGATATAGG - Intronic
1022584511 7:31593435-31593457 ATCTTATTAGATATGGTGAATGG + Intronic
1024404690 7:48964715-48964737 AGATTATGGCAGATGGAGGATGG - Intergenic
1024476476 7:49817193-49817215 AGCTTTTAACAGATGAATAATGG - Intronic
1028168718 7:87569429-87569451 AGCTTATAACAGATGTCCAAAGG - Intronic
1028770810 7:94618675-94618697 AACTTATTATAGATGGAAGATGG - Intronic
1030264562 7:107606431-107606453 AGCTTATTAAGTTTGGAGAAAGG - Intronic
1031014973 7:116563991-116564013 AACTTATTAATGATGGTGAATGG - Intergenic
1031686007 7:124732266-124732288 AGCATCTTTAAGATGGAGAACGG - Intergenic
1032334861 7:131016040-131016062 AGTCCATTACAGAAGGAGAAAGG + Intergenic
1032357411 7:131223611-131223633 AGCATTTTAGAGATGGAGAATGG - Intronic
1033511529 7:142064537-142064559 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1033514591 7:142093565-142093587 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1033784476 7:144714204-144714226 AGTTTATTAGAAATGCAGAAGGG - Intronic
1034885089 7:154793199-154793221 ATCTCATTATAGATAGAGAAGGG + Intronic
1040039843 8:42904797-42904819 AGCTTGGTACAGATCGAGTAGGG - Intronic
1040810520 8:51447779-51447801 GTCTTGTTACAGATGGAAAAAGG + Intronic
1042925695 8:73966315-73966337 AGCTTTTTATGGAGGGAGAATGG + Intronic
1043186242 8:77154210-77154232 AGCTCATCAGAGATGGGGAACGG - Intergenic
1043284504 8:78513041-78513063 AGCTTAATACAGACACAGAATGG + Intergenic
1044153951 8:88819254-88819276 AGCTTTTTAAAGATGTAGAATGG - Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1045830973 8:106459609-106459631 AGCTTATTGTAGATGGGGACAGG - Intronic
1046441338 8:114258631-114258653 ATCTTATTAAAAATGGACAAAGG + Intergenic
1046625022 8:116567615-116567637 AGAGTATTCCAGATGGACAAGGG - Intergenic
1047663808 8:127067628-127067650 AGATTATTACAGAGGGGGAAGGG + Intergenic
1047708392 8:127525368-127525390 AGCTGAGAACAGGTGGAGAAGGG - Intergenic
1047924827 8:129672438-129672460 GGATTATTACAGATCAAGAAAGG + Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050689264 9:8206966-8206988 GGCTTATAACACATTGAGAATGG + Intergenic
1050816263 9:9816626-9816648 AGCTTAAAAAAGATGGAAAAAGG + Intronic
1052256901 9:26467698-26467720 AGCTGGTTATAGGTGGAGAAGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055803454 9:80066792-80066814 ATCTTATTACAAACAGAGAAAGG - Intergenic
1059287276 9:113185416-113185438 AGCGTATCCCAGATGGAGAAGGG + Intronic
1059953030 9:119487570-119487592 ATTTTATTACAGAAGAAGAAAGG - Intergenic
1060262572 9:122089382-122089404 ACCTCATAACAGATGGGGAAAGG + Intronic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1062149907 9:135012679-135012701 AGGTCATCACAGATGGGGAAAGG - Intergenic
1187447410 X:19371823-19371845 CCCTTATTTCAGATGGAAAAGGG - Intronic
1187584438 X:20644459-20644481 AGCTTGTTATAAATGCAGAATGG - Intergenic
1187647679 X:21366792-21366814 AGTGTATGAGAGATGGAGAATGG - Intergenic
1187944412 X:24412350-24412372 ACCTAAATACAGATGGAGGAGGG + Intergenic
1188193708 X:27204206-27204228 ATATCATTACAGATGGAGTAGGG - Intergenic
1188754122 X:33939200-33939222 AGCTTTTTACTCATGGTGAAAGG - Intergenic
1188920824 X:35974491-35974513 AGCATATAAAACATGGAGAATGG + Intronic
1189731885 X:44029499-44029521 AGCAAAGTACAGATCGAGAAAGG + Intergenic
1191233651 X:58117161-58117183 GGTTTGTTACAGATAGAGAATGG - Intergenic
1191861635 X:65670292-65670314 AGCGTGTGACAGATGGAGAAAGG + Intronic
1192053538 X:67748408-67748430 AGATTCTAACAGAGGGAGAAAGG - Intergenic
1192142935 X:68660577-68660599 AGCTGAGTAGAGATGGAGGATGG - Intronic
1196550666 X:117020158-117020180 AGGTTATTACATATTGATAAAGG + Intergenic
1197169247 X:123412736-123412758 TACCTATTACAGATGGAAAAAGG - Intronic