ID: 907829491

View in Genome Browser
Species Human (GRCh38)
Location 1:58050942-58050964
Sequence TACATGCTACATGTTGTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907829490_907829491 -1 Left 907829490 1:58050920-58050942 CCAAATATTACTGATGCTCTACT 0: 1
1: 0
2: 0
3: 10
4: 151
Right 907829491 1:58050942-58050964 TACATGCTACATGTTGTTCTAGG 0: 1
1: 0
2: 1
3: 28
4: 203
907829488_907829491 22 Left 907829488 1:58050897-58050919 CCTAAGTATCCATAATTCATTCA 0: 1
1: 0
2: 4
3: 30
4: 267
Right 907829491 1:58050942-58050964 TACATGCTACATGTTGTTCTAGG 0: 1
1: 0
2: 1
3: 28
4: 203
907829489_907829491 13 Left 907829489 1:58050906-58050928 CCATAATTCATTCACCAAATATT 0: 1
1: 2
2: 55
3: 248
4: 909
Right 907829491 1:58050942-58050964 TACATGCTACATGTTGTTCTAGG 0: 1
1: 0
2: 1
3: 28
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907829491 Original CRISPR TACATGCTACATGTTGTTCT AGG Intronic
902489973 1:16774445-16774467 CACATGCAACATATTGTTCTTGG - Intronic
905336831 1:37250460-37250482 TGCATGCCTCATGCTGTTCTTGG + Intergenic
906647925 1:47489543-47489565 TATGTGCTAGATGTGGTTCTAGG + Intergenic
906929796 1:50158152-50158174 TATATGCCAGGTGTTGTTCTGGG - Intronic
907425660 1:54377835-54377857 TACATGATATATTTTATTCTAGG - Intronic
907829491 1:58050942-58050964 TACATGCTACATGTTGTTCTAGG + Intronic
907845528 1:58202793-58202815 TGGGTGCTACATGTTGTTTTTGG - Intronic
908172107 1:61515637-61515659 TACATGTTAGATACTGTTCTAGG - Intergenic
908502779 1:64760766-64760788 GACATCCCAAATGTTGTTCTTGG + Intronic
909702268 1:78539556-78539578 TAGATGAAACATGTTTTTCTTGG + Exonic
909905026 1:81184151-81184173 TACGTGCTATCTCTTGTTCTTGG - Intergenic
911478190 1:98400467-98400489 TATATGCTAGATATTGTTTTAGG + Intergenic
911490095 1:98553617-98553639 TGCATGCGTCATGTAGTTCTCGG - Intergenic
911563925 1:99440090-99440112 AACTTGCTACATCTTGATCTGGG + Intergenic
916458550 1:164996576-164996598 TTCATGGAACATTTTGTTCTGGG + Intergenic
917597889 1:176547921-176547943 TACATGTTACATGTAGCTGTGGG - Intronic
917788232 1:178482486-178482508 TAGATGCTACATGTTGATTTGGG + Intergenic
917865317 1:179189098-179189120 GACAATCTTCATGTTGTTCTCGG + Intronic
918439722 1:184555140-184555162 TATAGGCTAGATATTGTTCTAGG - Intronic
918480983 1:184976165-184976187 TACATGCTAGGTGCTCTTCTAGG - Intergenic
919227902 1:194731458-194731480 TTGATGATACATGTTGTTCCTGG - Intergenic
919582925 1:199399866-199399888 TACATCTTACATGTTTTGCTTGG + Intergenic
919612714 1:199765421-199765443 TTTATGCTACATTTTGTTCTTGG - Intergenic
919956870 1:202426209-202426231 TACATGCTTCTTGTAGCTCTTGG + Intronic
920048640 1:203150151-203150173 TTCCTGCTGCATGTTGTTCTGGG + Intronic
923222052 1:231904219-231904241 TAACAGCTACATGTTGTTCCAGG + Intronic
923530465 1:234808084-234808106 CACATGCAACATATTGTTCTTGG + Intergenic
1063847632 10:10148728-10148750 CACATGCTATCTGTTATTCTAGG + Intergenic
1064340744 10:14483254-14483276 TGCATGCAAAATGTTGTTCTAGG + Intergenic
1065669808 10:28103707-28103729 TACATTCTAGATGCTGTTCTGGG - Intronic
1066562648 10:36687409-36687431 TACATGCTGCACAATGTTCTTGG + Intergenic
1066698307 10:38098301-38098323 TACATGCTCTCAGTTGTTCTGGG + Intronic
1067900667 10:50237912-50237934 TACATGGTACATATAGTTATGGG - Intronic
1068854981 10:61788344-61788366 AACATGCTACCTTATGTTCTAGG - Intergenic
1071843243 10:89494904-89494926 GAAATGCTACATACTGTTCTTGG + Intronic
1075338838 10:121629385-121629407 TGCATGCCACATGCAGTTCTAGG + Intergenic
1079321511 11:19455346-19455368 TATATACTACTTGTGGTTCTAGG - Intronic
1080340199 11:31254008-31254030 CTCATGCTACATGTTGGTGTGGG - Intronic
1080849123 11:36052812-36052834 TACATGCAACTGGTTGTCCTTGG + Intronic
1081195865 11:40159898-40159920 TACATGCCAAATATTATTCTAGG - Intronic
1086730209 11:90240068-90240090 TACATGTGCCATGTTGTTGTTGG + Intergenic
1087641760 11:100762533-100762555 TACATGCCAAACTTTGTTCTGGG + Intronic
1087822305 11:102726321-102726343 TACATGCCACATGCTGTGATGGG + Intronic
1092480638 12:8856160-8856182 TACATGCTAGATATTGTGCTGGG - Intronic
1093209211 12:16287557-16287579 CACATGCTATTTCTTGTTCTTGG + Intergenic
1093266482 12:17009239-17009261 TCCCTGTTACATTTTGTTCTTGG - Intergenic
1093861799 12:24175067-24175089 TGCATGCTCCATGTAGTTTTCGG - Intergenic
1093980054 12:25466279-25466301 TACAAGGTACATGTCATTCTAGG - Intronic
1094659758 12:32457757-32457779 TATATGCTACATACTGTTCCAGG - Intronic
1094799185 12:34010793-34010815 TACAATATACATGTTGTTATTGG + Intergenic
1095111942 12:38304912-38304934 TACAATATACATGTTGTTATCGG + Intergenic
1095218754 12:39582588-39582610 TAAATGCTACATGTTTATCTTGG - Intronic
1095275939 12:40282290-40282312 TATTTGCTAGATGTTGTGCTAGG + Intronic
1096001186 12:48131887-48131909 TACTTGCTCCATGTTGTTTTAGG + Intronic
1100390599 12:94143224-94143246 TATATACAACATGTTGTGCTTGG - Intergenic
1102445650 12:113000279-113000301 TAAATGCCACATGTGCTTCTGGG - Intronic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1104073967 12:125373171-125373193 TACATGCCACATATAGTTCTTGG - Intronic
1104104296 12:125644555-125644577 TAAATGCCACATCTTGTGCTAGG - Intronic
1105895502 13:24714362-24714384 TCCATGCTCTATCTTGTTCTGGG - Intergenic
1107661940 13:42647809-42647831 TACATGATACATCATGTGCTTGG + Intergenic
1109243179 13:59917560-59917582 TACATATTTCATCTTGTTCTTGG - Intronic
1109758987 13:66801274-66801296 TACATTTTACACGTAGTTCTAGG - Intronic
1111854645 13:93622377-93622399 TACATGCCACATTTTTTTCAAGG + Intronic
1112185107 13:97120438-97120460 GACATGCTACCTATTCTTCTTGG + Intergenic
1115286613 14:31720996-31721018 TACATGCCACATACTATTCTAGG - Intronic
1115407296 14:33031829-33031851 TGCATGCTCCAGATTGTTCTAGG + Intronic
1120073411 14:80128191-80128213 TACATGCTGCATGTCTTACTAGG - Intergenic
1121126505 14:91410520-91410542 TACATGTTACATGTTTCTCTTGG + Intronic
1126200393 15:45979008-45979030 TACATGCTAACTGTTGGTGTGGG - Intergenic
1126780180 15:52133089-52133111 TATATGCTAGATATTATTCTAGG - Intronic
1127289280 15:57555755-57555777 AACATACTACATGGTGTTCATGG - Intergenic
1127501168 15:59555429-59555451 TATATGCTACATACTGTTCTAGG + Intergenic
1127619888 15:60723768-60723790 TACATGCAAGATCTTGCTCTTGG + Intronic
1129502467 15:76052565-76052587 TACATGTAACATTTTTTTCTTGG - Intronic
1134219833 16:12345214-12345236 TGCATGCTACACCTTCTTCTGGG + Intronic
1138016910 16:53436496-53436518 TACTTGCTACACATTGTTCTAGG + Intronic
1139769061 16:69257904-69257926 TACATGCCAAATATTGTGCTAGG - Intronic
1141460653 16:84176865-84176887 TACATTCAGCATGTTTTTCTGGG - Intronic
1144533754 17:16066598-16066620 AACATGTTACTTGTTTTTCTAGG - Intronic
1144610796 17:16712741-16712763 TGCATGCTACATTATTTTCTGGG - Intronic
1144901949 17:18602645-18602667 TGCATGCTACATTATTTTCTGGG + Intergenic
1144929117 17:18843301-18843323 TGCATGCTACATTATTTTCTGGG - Intronic
1145130555 17:20343424-20343446 TGCATGCTACATTATTTTCTGGG - Intergenic
1146683880 17:34827519-34827541 TGCATGCCACATGCTGTGCTGGG - Intergenic
1146960265 17:36969022-36969044 AACATGTTACATGTTTTTCTTGG + Intronic
1149033812 17:52112691-52112713 TATATGCTAGATGCTGGTCTAGG - Intronic
1149254228 17:54806758-54806780 TAAATCCTACATGTTCTTGTTGG + Intergenic
1149970456 17:61213089-61213111 TACATGCTAAATAGTGTGCTTGG - Intronic
1150185975 17:63181702-63181724 TACCTGCTAAATGTGGTCCTTGG - Intronic
1152052193 17:77988937-77988959 TATGTGCCACATGATGTTCTAGG - Intergenic
1153639852 18:7147456-7147478 TCCATGCTAAATGTTGTCTTGGG + Intergenic
1157478007 18:48035722-48035744 CACATGCTCCCTGTTCTTCTAGG + Intronic
1158104572 18:53871184-53871206 TATTTGCTACATATTGATCTAGG + Intergenic
1159392435 18:67810300-67810322 TAAATGCTAGATGTTGGTCCTGG + Intergenic
1159490743 18:69131125-69131147 TATATTCTACTTGTTGATCTGGG - Intergenic
1159694511 18:71538156-71538178 TAAATGCTAGATATTATTCTAGG + Intergenic
1162326049 19:10000299-10000321 GACATGCTCCATTTTGGTCTTGG - Intronic
1162747940 19:12809673-12809695 TGCATGCCACATACTGTTCTAGG - Intronic
1164185818 19:22868365-22868387 TACTTTCTAGATGTTCTTCTAGG - Intergenic
1165958003 19:39514169-39514191 TACATGCCAGATCTTATTCTGGG + Intergenic
927347456 2:22062343-22062365 TACATTCTGCATTCTGTTCTGGG + Intergenic
928259919 2:29757288-29757310 TACATGCCACATACTGTTCCAGG + Intronic
928265637 2:29809246-29809268 TATGTGCCACATGTTGTACTTGG + Intronic
929958647 2:46479797-46479819 TACATGTCACCTGATGTTCTTGG - Intronic
931701910 2:64916165-64916187 ACCATGCCACATTTTGTTCTAGG - Intergenic
932417892 2:71584661-71584683 TACATGCTCGATGTTGGACTGGG + Intronic
933326631 2:80846172-80846194 TTCATGCTACATTTTTTTCCTGG - Intergenic
933701224 2:85256658-85256680 AACATTCTACATCTTGATCTAGG + Intronic
935865433 2:107382433-107382455 TATGTGCCAGATGTTGTTCTGGG - Intergenic
937580466 2:123480790-123480812 TACATGCAAAATGTGGTTTTGGG + Intergenic
938452150 2:131431007-131431029 TACATGCAAAACGTTCTTCTAGG + Intergenic
939315347 2:140542355-140542377 TATATGCCATATGTAGTTCTGGG - Intronic
939316117 2:140551396-140551418 TTCATGCTCCCTGTTGTTGTTGG - Intronic
940534325 2:154920268-154920290 TACAGTTTACATGTTGGTCTTGG - Intergenic
940605033 2:155911204-155911226 GACATGCTACATGTATTTCTGGG + Intergenic
941860991 2:170280347-170280369 TAGATGCTACATATTGACCTTGG + Intronic
942296959 2:174527261-174527283 TACATGCTAGGTACTGTTCTAGG + Intergenic
942999108 2:182302050-182302072 TTCCTGCTACATATTCTTCTAGG - Intronic
944409388 2:199423293-199423315 TATGTGTTAGATGTTGTTCTAGG - Intronic
945125183 2:206501132-206501154 AAAAAGCTACAAGTTGTTCTTGG - Intronic
946564273 2:220946047-220946069 CACATCCTCCATGATGTTCTAGG + Intergenic
1172776613 20:37411124-37411146 CAGCTGCTACATGGTGTTCTAGG - Intergenic
1173077876 20:39837722-39837744 TATGTGCTACGTGGTGTTCTAGG + Intergenic
1174497039 20:50954036-50954058 TACATGGTAAATGTAGTTCTAGG - Intronic
1176341419 21:5700296-5700318 TACATTCTACAGGTTTTTTTTGG - Intergenic
1176473673 21:7132449-7132471 TACATTCTACAGGTTTTTTTTGG - Intergenic
1176503408 21:7624160-7624182 TACATTCTACAGGTTTTTTTTGG + Intergenic
1178107403 21:29335417-29335439 TACATGTTAAATGTTGTGCTTGG + Intronic
1178569123 21:33718206-33718228 TACATGCTACACATTATACTAGG - Intronic
1178721647 21:35016008-35016030 TACTTGATACATGTTATTTTAGG + Intronic
1184782021 22:46654340-46654362 CACATGCTCCATGCTGCTCTTGG + Intronic
949197975 3:1336251-1336273 TACATGCTAGATGGTGTACCAGG + Intronic
949312462 3:2715109-2715131 TACATTCTACTTGTTGCTTTAGG + Intronic
949778181 3:7655358-7655380 CACATGCTTCATCTTGTTATTGG - Intronic
949887932 3:8711274-8711296 TAAATGCCAAAAGTTGTTCTAGG - Intronic
952314716 3:32222566-32222588 TACACACTAAATATTGTTCTAGG - Intergenic
953846674 3:46433010-46433032 AACATCTTACATGTAGTTCTTGG + Intergenic
953904926 3:46863801-46863823 TACATGCTACGTGTTGTGTTGGG + Intronic
955934666 3:64091229-64091251 CACTTGCTACTTGTTGATCTTGG - Intergenic
955944996 3:64185083-64185105 TACATGTTAGATATTGTCCTTGG + Intronic
956839495 3:73124564-73124586 TAAATACTACGTGTTGGTCTTGG + Intergenic
957354689 3:79066329-79066351 TACATGCTATTTCTTGATCTAGG + Intronic
957941233 3:87007073-87007095 TAGATGCTTCATGTTATTCTGGG - Intergenic
958094243 3:88921661-88921683 TATGTGCCAGATGTTGTTCTGGG + Intergenic
961938827 3:130615726-130615748 CACATGATATATGTTTTTCTTGG - Intronic
962659883 3:137590892-137590914 TACATGCTACATTTTTATATAGG - Intergenic
963246022 3:143063670-143063692 GACATGCTACGTATTTTTCTGGG - Intergenic
963631966 3:147744755-147744777 TACTGGCTCTATGTTGTTCTAGG + Intergenic
969509284 4:7608469-7608491 TACATGCCAGGTGTTGTCCTGGG - Intronic
969848123 4:9935700-9935722 GAGATGCTGCATGTTGTTTTAGG + Intronic
970493559 4:16602164-16602186 TACAGGCCAGATATTGTTCTAGG + Intronic
970691544 4:18625989-18626011 TACATGCTACATATTTTTCTAGG - Intergenic
972124969 4:35753082-35753104 TACATGAGACATTTTGTTATAGG + Intergenic
974202467 4:58658814-58658836 TACACGCTACATTTTATCCTAGG + Intergenic
975646072 4:76547512-76547534 TATGTGCTCCATGCTGTTCTGGG + Intronic
975924213 4:79429511-79429533 TACATGGTACATGGTATGCTTGG - Intergenic
976981523 4:91237537-91237559 TACATGCTACATATTTTTAGAGG - Intronic
977922290 4:102658858-102658880 TACATGCTAGATGTTGTAACAGG - Intronic
978508853 4:109493583-109493605 TACATACTAAACATTGTTCTAGG + Intronic
981289219 4:143054631-143054653 TTGAGGCTACATGTTGTTCTAGG + Intergenic
981650751 4:147055398-147055420 TACAGTCTACATTTTGTCCTTGG - Intergenic
982358565 4:154494130-154494152 TACATGCTAGGTACTGTTCTAGG - Intergenic
983555324 4:169054386-169054408 TACATGCCACACCCTGTTCTAGG - Intergenic
983972636 4:173893387-173893409 TACATACCAGAGGTTGTTCTTGG - Intergenic
984892390 4:184505240-184505262 CACATGCTATATTTTCTTCTTGG - Intergenic
986855747 5:11866637-11866659 TACGTGCTAAATGTTTTTCGTGG + Intronic
986976073 5:13395705-13395727 TACATGCTTCATGGAGTTGTGGG + Intergenic
987296668 5:16559022-16559044 TAAATGCTCCAATTTGTTCTGGG + Intronic
987812456 5:22855650-22855672 TCCATGCTACATGTCCATCTAGG - Intergenic
993189378 5:84661855-84661877 TACATGCTCCATATTTTTCATGG - Intergenic
993688047 5:90965182-90965204 ATTATGCTACATGTTGCTCTAGG - Intronic
996894856 5:128469044-128469066 TATATACTAGATATTGTTCTGGG + Intronic
1003358240 6:5396149-5396171 TACATGCAACATGGAGCTCTTGG - Intronic
1006894204 6:37456248-37456270 AAGATGCTACATAATGTTCTTGG + Intronic
1009283645 6:61783444-61783466 TACATGCTAGATGCAGTGCTAGG - Intronic
1010337215 6:74700787-74700809 TACTTTCTACATGATGTTCTGGG - Intergenic
1010358913 6:74969541-74969563 TATATGCTATTTGGTGTTCTTGG - Intergenic
1010927074 6:81755613-81755635 TACGTGCTATATGCTGTGCTGGG + Intergenic
1011383119 6:86764398-86764420 CACATGCTAGAAGTTGTGCTAGG + Intergenic
1012541343 6:100365870-100365892 TATGTGCCAGATGTTGTTCTAGG + Intergenic
1012835872 6:104266498-104266520 TATATGCTGTATATTGTTCTAGG - Intergenic
1013459643 6:110362949-110362971 TACATGCCAGATACTGTTCTAGG - Intergenic
1015176718 6:130317365-130317387 TACGTGTTACTTATTGTTCTAGG + Intronic
1015209028 6:130675331-130675353 TACATGCTACATTCTGTGCTTGG - Intergenic
1020967949 7:14896306-14896328 TGCATGCCAGATGTTCTTCTGGG + Intronic
1021362854 7:19737957-19737979 TACATTCTACATTTTATTCTGGG - Intronic
1022005704 7:26263603-26263625 TACTGGCTTCATGATGTTCTAGG + Intergenic
1022629025 7:32067878-32067900 TATGTGCTAAATGCTGTTCTAGG + Intronic
1027243127 7:76346309-76346331 CAGATGCTACATTTTTTTCTGGG + Intronic
1027719244 7:81718280-81718302 TACATGCCACATTGTGTTGTAGG + Intronic
1031494515 7:122430202-122430224 TCCATGCTACCTTTTGTTCAGGG + Intronic
1037342600 8:17862469-17862491 TACATACTATATGTCCTTCTTGG + Intergenic
1037520015 8:19671538-19671560 TACACCCCAAATGTTGTTCTAGG + Intronic
1038465449 8:27758287-27758309 TACAGTCTACATCTTGTACTAGG - Intronic
1042470296 8:69179625-69179647 TACATGTAATATGTTATTCTGGG + Intergenic
1043162724 8:76866265-76866287 TACATGCTACTTGTTCATCTCGG - Exonic
1045872769 8:106945253-106945275 TACGTGCTACATGTATATCTAGG - Intergenic
1046637879 8:116692376-116692398 TACAAGCTACATATTTTTCTAGG + Intronic
1046785359 8:118259999-118260021 CACATGCCAAATGTTATTCTAGG + Intronic
1047277603 8:123417351-123417373 TATATGCCACGCGTTGTTCTGGG + Intronic
1047483363 8:125305918-125305940 TACAGGCTAAATGTTATTTTAGG + Intronic
1047796761 8:128265056-128265078 TGCATGCTAGATGTTCTGCTTGG - Intergenic
1048883443 8:138888850-138888872 TACATGCTAGGAGCTGTTCTAGG - Intronic
1049226560 8:141454181-141454203 TACATACTGGATGTTGTTTTTGG - Intergenic
1052981461 9:34452966-34452988 TCTCTGCTAGATGTTGTTCTGGG - Intronic
1055996413 9:82165046-82165068 TACTTCCTACATTTTCTTCTAGG - Intergenic
1056092577 9:83219022-83219044 TATATGTGACATGTTTTTCTAGG - Intergenic
1057750342 9:97787727-97787749 TCCATGCAACATCTTGTTCATGG - Intergenic
1058227845 9:102388829-102388851 GACATACTACATGATGTTATAGG - Intergenic
1058727032 9:107814150-107814172 TACACCCTACTTGTGGTTCTGGG + Intergenic
1058843800 9:108935514-108935536 TACATGCTGCATGCTGATCACGG - Intronic
1059024492 9:110610988-110611010 TACATGCTACAGGTCCTTGTTGG - Intergenic
1059042459 9:110829606-110829628 TCCATGCAACATGTTGTCCAGGG + Intergenic
1061209779 9:129184350-129184372 TACATGTTACACGTTGTCCTGGG - Intergenic
1187016905 X:15338208-15338230 TACCTCATTCATGTTGTTCTTGG - Intergenic
1188613698 X:32131306-32131328 TATATGCCAAATGTTTTTCTAGG - Intronic
1188851794 X:35141224-35141246 TCCATGCTACCTTTTGTTCGGGG - Intergenic
1189901316 X:45709877-45709899 TATGTGCTACACTTTGTTCTAGG - Intergenic
1190130850 X:47747685-47747707 AGGATGCTACATGCTGTTCTGGG - Intergenic
1192296162 X:69850852-69850874 CACATACTACATGTTATGCTTGG + Intronic
1193844998 X:86457558-86457580 TACATGCTAGGTTTTGTTTTAGG + Intronic
1194120115 X:89951483-89951505 AACATGCCACTTGTTGTTCAGGG + Intergenic
1194819177 X:98485101-98485123 TACATACTAGATATTCTTCTAGG + Intergenic
1195680754 X:107544565-107544587 TACATGCCACACACTGTTCTAGG - Intronic
1196307427 X:114120992-114121014 TAAATGATAAATCTTGTTCTTGG + Intergenic
1196961823 X:121011685-121011707 TATATGCTCCTTGTTTTTCTTGG + Intergenic
1197041179 X:121937746-121937768 TACATACTACATATTCTTATTGG - Intergenic
1197674103 X:129311496-129311518 TAAAAGATCCATGTTGTTCTCGG - Intergenic
1198331101 X:135623653-135623675 TAGAATCTGCATGTTGTTCTTGG - Intergenic
1198363630 X:135919786-135919808 TAGAATCTGCATGTTGTTCTTGG - Intergenic
1199827391 X:151514273-151514295 TACATGCTCCAAGTTGTGCTGGG - Intergenic
1200472977 Y:3609004-3609026 AACATGCCACTTGTTGTTCAGGG + Intergenic