ID: 907832175

View in Genome Browser
Species Human (GRCh38)
Location 1:58075385-58075407
Sequence CTGTGTCACTTCCAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907832175 Original CRISPR CTGTGTCACTTCCAAGTGGA AGG Intronic
902038745 1:13476798-13476820 AAGTGGCACTACCAAGTGGAGGG - Intronic
902933853 1:19750204-19750226 TTAAGTCAGTTCCAAGTGGAAGG + Intronic
903025812 1:20429324-20429346 CTGTGGCACTGCAAAGTGGAAGG - Intergenic
903454854 1:23480445-23480467 AGGTGACACTTCCAGGTGGAAGG - Intronic
903522483 1:23961426-23961448 CTTTGTCACCTACAAGTGAATGG - Exonic
905462896 1:38133194-38133216 CTGTGTCCCCTCCCTGTGGAGGG - Intergenic
906020832 1:42628003-42628025 CTGTGGCTCTTCCAGGTGCATGG - Intronic
907832175 1:58075385-58075407 CTGTGTCACTTCCAAGTGGAAGG + Intronic
908094414 1:60721792-60721814 CTGTGGCTTTTCCAAGTGCATGG - Intergenic
909271559 1:73628913-73628935 CTGGGGCACTACCTAGTGGAGGG - Intergenic
910291413 1:85603510-85603532 CCAAGTCACTTCCAAGTGTAAGG - Intergenic
910774485 1:90861670-90861692 CTGTGGCTTTTCCAAGTGGACGG + Intergenic
911783646 1:101916310-101916332 CTGTCTGACTTCCAAGTTCAAGG + Intronic
911841543 1:102688498-102688520 CTGAGTCACTTCCTAGGGGAGGG - Intergenic
912537194 1:110383491-110383513 CTGAGTCACTTCTGGGTGGAAGG + Intronic
915148981 1:153814068-153814090 CTGTGTCAATTCAAAGTCAAAGG + Intronic
918231149 1:182533604-182533626 ATCTGTCACTTCCTAGTTGAAGG + Intronic
921302825 1:213766860-213766882 CTCTGTCACCTCCAAGGAGATGG + Intergenic
922524139 1:226284903-226284925 CTTTTTATCTTCCAAGTGGATGG + Intronic
924386782 1:243506496-243506518 CTCTGTCACTCCGAAGAGGAGGG + Intronic
1063515805 10:6693886-6693908 CTGTGTTACTTCAGAGTGGGAGG - Intergenic
1063618735 10:7625458-7625480 CTGAGTCACTTCTAAGTGTTTGG - Intronic
1065919682 10:30381604-30381626 CTGTGTCATTTCCAATTAGCAGG + Intergenic
1066618745 10:37322572-37322594 CTGTGTGACTTCCCAATAGATGG - Intronic
1067528257 10:47051335-47051357 ATGGGGCACTTCCAAGTGGATGG + Intergenic
1068439031 10:57028415-57028437 CTGTGTCACCTCCTGGTGGAGGG - Intergenic
1068484236 10:57636134-57636156 CTGTGTCATTTCATGGTGGAAGG + Intergenic
1068931605 10:62596113-62596135 CTCTTTGACCTCCAAGTGGAAGG + Intronic
1069550881 10:69363175-69363197 CTGTGTCACTGCCATGTGTAAGG + Intronic
1069615048 10:69801683-69801705 AAGTGTCACTTCAAAGAGGACGG + Intergenic
1070468419 10:76749757-76749779 CTGTGTCTCTGACAAGGGGAAGG + Intergenic
1070543655 10:77435866-77435888 CTCTGTCACTGCCAGGTGGATGG - Intronic
1070636328 10:78131079-78131101 CTGAGTCACTTGAAAGTGGGTGG + Intergenic
1071280085 10:84093714-84093736 CTGTGTCAGCCCCAAGTGGCTGG + Intergenic
1072269330 10:93760478-93760500 CTATGTAACTTCCTAGGGGAAGG - Intronic
1073929297 10:108555720-108555742 CTGTGGCTCTTCCAGGTGCATGG - Intergenic
1074429114 10:113378148-113378170 ATGTGTCACTTCCTACTGCAAGG - Intergenic
1074954279 10:118372419-118372441 CTGTCTCGCTCCCAAGTAGAGGG - Intergenic
1075912178 10:126133995-126134017 CTGGAGCACTTCCTAGTGGAAGG - Intronic
1078482263 11:11687774-11687796 CTGTGGCTTTTCCAGGTGGACGG - Intergenic
1079581166 11:22066567-22066589 CTGTGTCACTTTTGGGTGGATGG - Intergenic
1080817479 11:35772410-35772432 CTGTGACTTTTCCAAGTGCATGG - Intronic
1081626421 11:44658711-44658733 CTGTGGCACTTCCTAGTTCATGG + Intergenic
1082140522 11:48603425-48603447 CTGAGTCTCTTCTAGGTGGAGGG + Intergenic
1083579319 11:63814346-63814368 CTGTGGCTCCTGCAAGTGGAAGG - Intronic
1085330665 11:75647381-75647403 ATGTGTAACTTCCACGTAGAAGG + Intronic
1085532249 11:77198768-77198790 CTCTGGCACCTCCTAGTGGAGGG + Intronic
1086848631 11:91782848-91782870 CTGTGACTTTTCCAGGTGGATGG + Intergenic
1087756651 11:102061750-102061772 CTCTGTCACTTCCACGTTGATGG + Intronic
1088560811 11:111114296-111114318 CTGAGTCACTTCTTAGAGGAGGG - Intergenic
1091711448 12:2743448-2743470 CTGTGTCTCTTCCCAGTTCATGG + Intergenic
1092996357 12:13954497-13954519 CTGAGTCACATCCAAGTTCAGGG + Intronic
1093624286 12:21327445-21327467 CTGTGGCTTTTCCAAGTGCATGG - Intronic
1094059065 12:26294190-26294212 CACTGTTCCTTCCAAGTGGAGGG - Intronic
1098325607 12:69298688-69298710 CTGAGGCACTGCCTAGTGGAGGG + Intergenic
1098628315 12:72699618-72699640 CTGTGGCTTTTCCAAGTGCATGG + Intergenic
1099450783 12:82803842-82803864 TTGGGTCTCTTCCAAGTGTATGG + Intronic
1099735412 12:86562364-86562386 CTGTCCCAATTCCAAGTGGCAGG - Intronic
1100164498 12:91901133-91901155 CTGTGGCTTTTCCAAGTGCATGG - Intergenic
1101157257 12:101939538-101939560 CTGTGTCTCTCCCAAGGGAAAGG - Intronic
1104110784 12:125702262-125702284 CTGTGTCCCCACCAGGTGGAGGG + Intergenic
1106171840 13:27295359-27295381 CTTTGCCACTTCCAAGGGCATGG + Intergenic
1106314563 13:28581919-28581941 CTGTTGCACTTCCAAGTTTAAGG + Intergenic
1107063712 13:36189050-36189072 AGGTGTAACTCCCAAGTGGATGG - Intronic
1108323511 13:49308272-49308294 CTGGGACATTTCCAAGGGGAGGG + Intergenic
1109476123 13:62882319-62882341 CTGTGGCTTTTCCAAGTGGATGG + Intergenic
1109906284 13:68846255-68846277 CTGTGGCTCTTCCAGGGGGATGG - Intergenic
1111044653 13:82798443-82798465 CTGTGTCATGTCCTGGTGGAAGG - Intergenic
1111221365 13:85208806-85208828 CTGTGGCATTTCCAGGTGCATGG - Intergenic
1112234484 13:97623434-97623456 CTCTGTCACTTCCAGGAGAAGGG + Intergenic
1114533795 14:23410790-23410812 CTGGGTCACTTGCAAATGCAAGG - Intergenic
1117020598 14:51566288-51566310 ATGTGTCACATCCAAGTGGCTGG - Intronic
1119634767 14:76264896-76264918 AAGTGTCACTTCCATTTGGAAGG + Intergenic
1121183355 14:91946151-91946173 CTGTGGCTCTTCCAAGAGGCTGG - Intronic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1124413877 15:29458571-29458593 CTGGGTCACCTCCAAGTCCAGGG - Intronic
1127010183 15:54617037-54617059 CTATGACACTTCTAAGTGGTAGG - Intronic
1128253780 15:66182275-66182297 CTGTGGCACCTACAAGTGGCAGG - Intronic
1130353959 15:83113396-83113418 CTGCTTCACTTTCAAGTGGAGGG - Intronic
1131187075 15:90283824-90283846 CTGTGTCATTTCCAATTAGCAGG - Intronic
1132194051 15:99896991-99897013 CTGTGACTTTTCCAGGTGGATGG + Intergenic
1135644714 16:24151925-24151947 CTGTCTCTCTTCCATGTGGAAGG + Intronic
1137068836 16:35879878-35879900 TTGTTTCATTTCCAAGTGGTTGG + Intergenic
1137658845 16:50185674-50185696 ATGTGTCAAATCCCAGTGGAAGG - Intronic
1140549524 16:75849769-75849791 CTGTTTCATTTCCTAGTGTATGG + Intergenic
1140879473 16:79184819-79184841 CTGTCTCACTGCCAAGAGCATGG - Intronic
1142372134 16:89688580-89688602 CCGTGTGACTTCCAGGTGAAAGG - Intronic
1146219069 17:31002681-31002703 CTGTGTCCCATCAAAGTGGAAGG - Intergenic
1148254753 17:46120109-46120131 AAGTATCACTTCTAAGTGGAAGG + Intronic
1148835274 17:50462639-50462661 CTGTGACACTTCCGCGGGGATGG + Intronic
1150343206 17:64385377-64385399 CTGAGTCATTTCCAGGTTGAGGG - Intronic
1153213078 18:2789412-2789434 CTGTGTCAAGGCTAAGTGGAAGG + Intronic
1153750776 18:8228099-8228121 GTGGGTTACTCCCAAGTGGAGGG + Intronic
1154004106 18:10512241-10512263 TTGTGTAACCTCCATGTGGAAGG + Intergenic
1154171123 18:12051025-12051047 TTGTTTCATTTCCAAGTGGTTGG + Intergenic
1156049433 18:32914132-32914154 CTGTGGAACATCCAAGTAGAGGG + Intergenic
1156251062 18:35352882-35352904 CTGTGGCTTTTCCAAGTGCAGGG - Intergenic
1159996582 18:74970712-74970734 CTGTGGCATTTCCAGGTGCACGG + Intronic
1160497642 18:79384483-79384505 CTGAGTCACATCCCTGTGGATGG - Intergenic
1160570923 18:79817237-79817259 CTGTGTAACATCCATGTGGCAGG - Intergenic
1161726111 19:5930002-5930024 CTGTGTCCCATCCCAGGGGACGG - Intronic
1164565991 19:29326483-29326505 CTGAGTCACTTAAAAGTGGGTGG + Intergenic
1164881314 19:31734876-31734898 CAGTGCCACTTCCAGCTGGATGG + Intergenic
1167665552 19:50821173-50821195 CTGTGTCTCTCCAGAGTGGAGGG + Intronic
1168418148 19:56182521-56182543 TTATGTCATTTCAAAGTGGAGGG - Intronic
926522847 2:13938199-13938221 CTGTATCACTGCCATGTTGAAGG + Intergenic
926779466 2:16454753-16454775 CTGTGTCACATAGAAGTGAATGG + Intergenic
928607577 2:32957746-32957768 CTGTGTTTCTTACAAATGGAAGG - Intronic
928797570 2:35040591-35040613 CTGTGGCTTTTCCAAGTGCATGG - Intergenic
933518491 2:83337551-83337573 CTCTGTCACTTACTAGTAGAAGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935309273 2:101767148-101767170 CTGCCTCACTTCCCACTGGAGGG + Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
938391435 2:130909705-130909727 CTGTGACACTGCCAAATGCAAGG - Intronic
939622291 2:144435236-144435258 CTGTGTCACGTCTAAGCTGAAGG - Intronic
944471026 2:200054532-200054554 CTGTGCCACTCCCAGGTGGGCGG - Intergenic
946005606 2:216522077-216522099 CTGAGTCACTTCCAAAGGGCTGG - Intronic
946632918 2:221690737-221690759 GCATGTCACTTCCAAGTGAAAGG + Intergenic
946924857 2:224616467-224616489 ATGTGTCACTTCCTGGGGGAAGG - Intergenic
947155633 2:227160412-227160434 CTGTGTCACATCTAGGAGGAAGG + Intronic
948190116 2:236051789-236051811 CTGTGTCCCTTCCCGCTGGAAGG + Intronic
1170548135 20:17452536-17452558 CTGTGTCAGTTTCAAGCGTAAGG + Intronic
1174047802 20:47746179-47746201 CTGATTCAATTCCAAGTGAAGGG + Intronic
1174409191 20:50322519-50322541 CTGTGTCACCACCCAGTAGAAGG - Intergenic
1174637711 20:52016254-52016276 CTGTCTCAGTGCCAAGTGCAGGG + Intergenic
1177258646 21:18699998-18700020 CTGTGTCTTTTCCAGGTGCATGG - Intergenic
1177890438 21:26798106-26798128 CTGTGACACTTTCCTGTGGACGG - Intergenic
949591994 3:5504290-5504312 ATGTGTAAAATCCAAGTGGAAGG + Intergenic
949644511 3:6077508-6077530 CTGTGTCTCTTCCCAGTGCCAGG - Intergenic
950513081 3:13445100-13445122 CTGTCTCACTTCCAAGTAGCTGG - Intergenic
950928705 3:16768207-16768229 TTGTTTCACTTCCCAGTTGAAGG - Intergenic
951960165 3:28309251-28309273 CTGTGAAACATCCAAGTAGAAGG - Intronic
952137207 3:30436653-30436675 CTGTGTCACTTGCAAAGTGAGGG - Intergenic
953573217 3:44089586-44089608 CTGTGGCATTTCCAGGTCGATGG + Intergenic
953793250 3:45964546-45964568 CTGGGTCACTTCTAAATGGAGGG + Intronic
953808470 3:46091956-46091978 CTGTGTCATTGCAAAGTAGAAGG + Intergenic
953853762 3:46485237-46485259 CCGCCTCACTTCCCAGTGGACGG - Intergenic
955395465 3:58554126-58554148 CTGTGGTTTTTCCAAGTGGATGG + Intergenic
956208583 3:66779515-66779537 TTGTATTACTTCCAGGTGGAGGG + Intergenic
957762131 3:84572448-84572470 CTGTGGCTTTTCCAGGTGGATGG + Intergenic
958256595 3:91332330-91332352 CTGTGTCTTTTCCAGGTGCAGGG - Intergenic
959950670 3:112176258-112176280 CTGTGTCACTCCCAGGTGGGTGG + Intronic
959957010 3:112251251-112251273 CTGTGTCACTCCTAGGTGGGTGG - Intronic
960814866 3:121662029-121662051 CTCTGTCACTTCCAAATCTAAGG + Intergenic
961701942 3:128751281-128751303 CTGTAGCTTTTCCAAGTGGATGG - Intronic
964375989 3:156049732-156049754 CTGAGTCACTGCCTAGAGGAGGG - Intronic
964545386 3:157828442-157828464 CTGTGGCTTTTCCAAGTGCATGG + Intergenic
965598145 3:170427833-170427855 CTTTGTCACTTCCCACTGAAAGG - Intronic
965893213 3:173540533-173540555 ATGTGTCACTTCCAGGTGGAGGG - Intronic
966883126 3:184361007-184361029 CTGTGTCCCTGCCATGTGCATGG - Intronic
968033493 3:195524540-195524562 ATGTGTCACTTCCCTGTGGGGGG - Intronic
968864032 4:3196258-3196280 CAGGGTCCCTTCCAGGTGGAGGG - Intronic
970142602 4:12998424-12998446 CTGAGCCACTTCCCAGTGGGAGG - Intergenic
970361299 4:15311129-15311151 CTGTGGCATTTCCATGTGCACGG - Intergenic
971240729 4:24886513-24886535 CAATAGCACTTCCAAGTGGAGGG - Intronic
975454380 4:74573099-74573121 CTCTGTCACTTCCAAGCTGAGGG + Intergenic
975906176 4:79214870-79214892 CTGTGTCATTCCCTGGTGGAAGG - Intergenic
976051164 4:81012677-81012699 CTGTGGCTCTTCCAGGTGCATGG - Intergenic
976931797 4:90575291-90575313 CTGTGTCATTCCATAGTGGAAGG + Intronic
979203987 4:118012334-118012356 CTGTGTCATCCCCTAGTGGAAGG - Intergenic
981576725 4:146213414-146213436 CTGTGTCAGGACCCAGTGGAGGG + Intergenic
985331924 4:188846693-188846715 GTGTGTGATTTCTAAGTGGAAGG + Intergenic
985337663 4:188913831-188913853 CTGTGGCTTTTCCAAGTGCATGG + Intergenic
985397801 4:189563307-189563329 CTGTGTCCGTATCAAGTGGAGGG - Intergenic
988928880 5:36016056-36016078 CTGTGGCATTTCCAAGTACAGGG - Intergenic
989269979 5:39521542-39521564 TTGTGTCCTTTCCATGTGGAAGG - Intergenic
989405115 5:41051681-41051703 CTGTGTCCTTACCTAGTGGAAGG - Intronic
989490576 5:42048081-42048103 CTGTGTCAATCCCATGTGGGTGG - Intergenic
990797795 5:59564375-59564397 CTCTCTCACTTCCAAGTTCATGG - Intronic
991245088 5:64502275-64502297 CTGTCTGACTGCCAAGTAGAAGG - Intergenic
991638232 5:68727708-68727730 GTCTGTCACTTCCAGTTGGAAGG + Intergenic
991776397 5:70089747-70089769 CTGTGGCTTTTCCAAGTGCAGGG - Intergenic
991855684 5:70965194-70965216 CTGTGGCTTTTCCAAGTGCAGGG - Intergenic
991869698 5:71097972-71097994 CTGTGGCTTTTCCAAGTGCAGGG - Intergenic
992555221 5:77896510-77896532 CTGTTTCTCTTCCACTTGGAGGG - Intergenic
994576531 5:101586232-101586254 CTGTGGCTCTTCCAGGTGCACGG - Intergenic
996102004 5:119453506-119453528 CTCTGTAACCTCCAAGTGCAGGG + Intronic
998083632 5:139297642-139297664 CTGTGGCACTTCTGTGTGGATGG + Intronic
1001014155 5:168125641-168125663 CTGTCTCACTACCCAGAGGAAGG - Intronic
1003000277 6:2325428-2325450 CTGTGGCTCTTCCAGGTGAATGG - Intergenic
1005404399 6:25470729-25470751 CTGTGTCTTTACTAAGTGGAAGG + Intronic
1008499823 6:52169887-52169909 CTGTGGCTTTTCCAAGTGCAAGG + Intergenic
1008998746 6:57688830-57688852 CTGTGTCTTTTCCAGGTGCAGGG + Intergenic
1009052022 6:58287625-58287647 CTGTGTCACATCCCACTTGAAGG - Intergenic
1009187230 6:60588209-60588231 CTGTGTCTTTTCCAGGTGCAGGG + Intergenic
1009777920 6:68229814-68229836 CTGTGTCACATCTAAGAGGATGG - Intergenic
1012224190 6:96686235-96686257 CTGTGGCTTTTCCAAGTGCATGG - Intergenic
1012478166 6:99637365-99637387 CTGTGGCTTTTCCAGGTGGATGG + Intergenic
1013695136 6:112692954-112692976 CTATGTCACATCCAAGTTGTGGG + Intergenic
1013904383 6:115198287-115198309 CTGTGGCTTTTCCAAGTGGATGG + Intergenic
1015478859 6:133684886-133684908 CAGTGTCACTACCAAATGGTTGG + Intergenic
1015728728 6:136326145-136326167 CCTTGTCACTTCCATCTGGAGGG + Intergenic
1019698228 7:2459869-2459891 CTGTGGCCCTTCCCACTGGATGG + Intergenic
1019925997 7:4192160-4192182 CTGTGTCAGTTACAGATGGAAGG + Intronic
1023786935 7:43717222-43717244 CTGTGACTTTTCCAGGTGGATGG - Intronic
1023910014 7:44547180-44547202 CTGTGTCTCTTCCAAGTAGCTGG - Intergenic
1024061324 7:45700694-45700716 CTGTGTCACTTGCAGGAGGGAGG + Intronic
1024231398 7:47366650-47366672 CTGTGTGACTCCAAAGAGGATGG + Intronic
1024695658 7:51854273-51854295 CTGTGTCACTTTTCATTGGATGG + Intergenic
1026532617 7:71212565-71212587 CTGTGGCTCTTCCAGGTGCACGG - Intronic
1029454614 7:100662628-100662650 CTGTCTCACTCCCAAGTGGCTGG + Intergenic
1029620102 7:101684951-101684973 CTGTATCACTTACAAATGGAGGG + Intergenic
1030072729 7:105711730-105711752 CTGTGGCACTTCCAGGCGCATGG + Intronic
1030655875 7:112167272-112167294 CTGTTCCACTTGCAAATGGAGGG - Intronic
1030868798 7:114731745-114731767 CTGTGTCTTTTCCAGGTGCACGG - Intergenic
1031716671 7:125116963-125116985 CTTTTTCATTTCCAAGTGGAGGG - Intergenic
1032670132 7:134074698-134074720 CTGTTAGACTGCCAAGTGGAGGG + Intergenic
1034573095 7:151972991-151973013 CTGTGTCTTTTCCAAGTGCATGG - Intronic
1037243441 8:16804234-16804256 CTGTGGCTCTTCCAGGTGCATGG + Intergenic
1037694834 8:21214472-21214494 TTTGGTCACTTTCAAGTGGAGGG - Intergenic
1038363363 8:26905734-26905756 CTGTGTGGCTACCTAGTGGAAGG + Intergenic
1039190759 8:34971602-34971624 CTGTGTCACTTACAGGAAGAAGG - Intergenic
1041719039 8:60959899-60959921 CTGTGTCATTTCATGGTGGAAGG + Intergenic
1042168683 8:65971730-65971752 TTCTGTCACTTGCAATTGGAAGG - Intergenic
1043030787 8:75131078-75131100 CTGTGGCTCTTCCAGGTGCATGG - Intergenic
1044777111 8:95701394-95701416 CTGTCTCTCTTCCAAGGGCAGGG - Intergenic
1045004239 8:97903366-97903388 TTGTGTCAGTTCCACATGGAAGG + Intronic
1046739668 8:117814716-117814738 CTTTGTCTCTTCAAAGTTGATGG - Intronic
1049311402 8:141935733-141935755 CTGAGTACCTTCCACGTGGAGGG - Intergenic
1049532641 8:143162137-143162159 CTGTGTGGGTGCCAAGTGGAGGG - Intergenic
1050463638 9:5897990-5898012 CTGTGTCATATCATAGTGGAAGG + Intronic
1050928995 9:11300928-11300950 CTGTGGCTTTTCCAAGTGCATGG + Intergenic
1051251218 9:15160954-15160976 CTGTGTCATCCCAAAGTGGAAGG + Intergenic
1051865256 9:21673270-21673292 CTGTGTCACTTCTATTGGGAAGG + Intergenic
1052688225 9:31780811-31780833 CTGTGGCTTTTCCAGGTGGATGG + Intergenic
1055704704 9:78985021-78985043 CTGTGACTGTTCAAAGTGGAAGG + Intergenic
1056226791 9:84503794-84503816 GTGTGTCTCTTCCAGGAGGAAGG - Intergenic
1059052988 9:110948620-110948642 CTGTGTCAGTCCTAAGAGGAAGG + Intronic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1189674283 X:43444544-43444566 CTGTGTTGCTCCCAAGTGGGTGG + Intergenic
1189886117 X:45546370-45546392 CTGTGTCTTTTCCAGGTGCAGGG - Intergenic
1190309802 X:49109084-49109106 CTGTGTCATTCCATAGTGGAGGG - Intergenic
1190946236 X:55096545-55096567 CTGTGTGTCATCCAAGTGGTGGG + Intronic
1192689728 X:73349600-73349622 CTGTGGCTTTTCCAAGTGCATGG - Intergenic
1193183244 X:78483239-78483261 CTGTGGCTTTTCCAAGTGCATGG + Intergenic
1193541809 X:82781844-82781866 CTGTGGCTTTTCCAGGTGGATGG + Intergenic
1193777212 X:85657696-85657718 CTGTGGCTCTTCCAGGTGCATGG - Intergenic
1194952676 X:100145363-100145385 CTGTGGCATTTCCAGGTGCACGG - Intergenic
1195280093 X:103324015-103324037 CTGTGTCAGTTTTGAGTGGATGG - Intergenic
1195370525 X:104167666-104167688 CTCTGTCTCTTCAAAGGGGAAGG - Intronic
1196996321 X:121388025-121388047 CTGTGGCTTTTCCAAGTGCATGG - Intergenic
1197092909 X:122559652-122559674 CTGTGTCACTCCTAGGTGGATGG - Intergenic
1197835061 X:130685700-130685722 CTGGTTCACTTCCACATGGAAGG - Intronic
1201906159 Y:19087431-19087453 TTGTGTCACTTCCAAGATGGTGG - Intergenic