ID: 907832440

View in Genome Browser
Species Human (GRCh38)
Location 1:58077825-58077847
Sequence CTGCCCTCTGAGACTTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907832440_907832445 -8 Left 907832440 1:58077825-58077847 CCACCTCAAGTCTCAGAGGGCAG 0: 1
1: 0
2: 1
3: 19
4: 169
Right 907832445 1:58077840-58077862 GAGGGCAGGGTGCAAGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907832440 Original CRISPR CTGCCCTCTGAGACTTGAGG TGG (reversed) Intronic