ID: 907832440

View in Genome Browser
Species Human (GRCh38)
Location 1:58077825-58077847
Sequence CTGCCCTCTGAGACTTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907832440_907832445 -8 Left 907832440 1:58077825-58077847 CCACCTCAAGTCTCAGAGGGCAG 0: 1
1: 0
2: 1
3: 19
4: 169
Right 907832445 1:58077840-58077862 GAGGGCAGGGTGCAAGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907832440 Original CRISPR CTGCCCTCTGAGACTTGAGG TGG (reversed) Intronic
901125339 1:6925034-6925056 CTGGCCTTGGAGCCTTGAGGAGG + Intronic
901800570 1:11705809-11705831 CTGGCCCCTGAGACTTGACTCGG - Intronic
901845309 1:11978420-11978442 CTGCCCTCAGAGAATGGAAGTGG + Intergenic
903260093 1:22126974-22126996 CTTCCCTCTCAGACCTCAGGAGG + Intronic
903541389 1:24098383-24098405 CTGCTCTCTGAGAAAGGAGGAGG - Intronic
903755088 1:25655000-25655022 CTGTCCTCTGATAATTGAAGTGG + Intronic
904923799 1:34029892-34029914 CTGCCCTGTGAGTCTTGCTGTGG + Intronic
906177067 1:43783743-43783765 CTGCCCTCTAAGACTGCGGGGGG - Intronic
906349192 1:45042981-45043003 CTGTCCTCTAAGTTTTGAGGGGG - Intronic
907109931 1:51917950-51917972 CTGCCCGCTGACTTTTGAGGTGG + Exonic
907832440 1:58077825-58077847 CTGCCCTCTGAGACTTGAGGTGG - Intronic
908179305 1:61588413-61588435 CTGCCCTCTGGGAGTTAATGGGG - Intergenic
908271222 1:62424558-62424580 CTAACCTCTGAGCCTTCAGGGGG - Intergenic
909876328 1:80808908-80808930 ATGGCCTCAGAGCCTTGAGGAGG - Intergenic
910160041 1:84262940-84262962 CAGTCCTCTGAGCCTTGTGGGGG - Intergenic
915062008 1:153193878-153193900 CAGCCCTCATAGACCTGAGGAGG - Intergenic
916240358 1:162633136-162633158 CTTCCCCCTGAGATTTGGGGTGG + Intronic
916616706 1:166449139-166449161 CTGCCCTCTGTGACTAGTTGAGG - Intergenic
917494407 1:175526961-175526983 CTGCCCTCTGTGCCAGGAGGTGG + Intronic
1063188317 10:3670065-3670087 TTGCCCCCAGAGACATGAGGAGG - Intergenic
1067529215 10:47058426-47058448 ATGCCATCTGAGACTGAAGGTGG + Intergenic
1069723109 10:70561939-70561961 CTGCCCTCCGTGCCTGGAGGGGG - Intronic
1070503346 10:77091637-77091659 CTGCGCTCTGAGACTTGGGCAGG + Intronic
1070947531 10:80405934-80405956 CTGCCCTATGGGACTTGTGAGGG + Intergenic
1073549716 10:104386566-104386588 CTCCCCTCTGGCAGTTGAGGAGG + Intronic
1075582650 10:123633969-123633991 CTGCCCTCTGTGACTCCATGAGG - Intergenic
1076454505 10:130580431-130580453 CTGCCCTCAGAGACTTGCGCAGG - Intergenic
1076683246 10:132186054-132186076 CTGCCCTCGGGGACTTGCTGCGG - Intergenic
1077414019 11:2416131-2416153 CTTCACGCTGGGACTTGAGGGGG + Intronic
1081789700 11:45774262-45774284 GCTGCCTCTGAGACTTGAGGGGG + Intergenic
1084432048 11:69116557-69116579 CTCTCCTCTGAGCCTTCAGGAGG + Intergenic
1084651030 11:70489608-70489630 TTGCCCTGTGAGAGTTGTGGAGG - Intronic
1084738596 11:71122813-71122835 GTTCCTTCTGAGGCTTGAGGGGG - Intronic
1084801466 11:71547051-71547073 CTGGCCTCAGTGACTTGAGGAGG + Intronic
1085255797 11:75172285-75172307 CTGGCCTCTGAGACATGAGGTGG - Intronic
1085394512 11:76200544-76200566 CTGCCCTCTGAGGTGTGAAGTGG - Intronic
1089133922 11:116234399-116234421 CTGACCTCTCAGACTTGGGTAGG - Intergenic
1091139171 11:133220703-133220725 TTGCTCTCTGAGACTTTTGGGGG - Intronic
1096424255 12:51487758-51487780 CAGCCATCAGAGACTTGAGAAGG - Intronic
1096761320 12:53844295-53844317 CTCGCCTCTGAGCCTTGAGGGGG + Intergenic
1103216840 12:119208178-119208200 CAGCTCTCTGAGGCTTCAGGTGG + Intronic
1103524322 12:121557685-121557707 CTGCCCCTAGAGACTTCAGGGGG + Intronic
1104136007 12:125939617-125939639 TTGCCCTCTGACAGTGGAGGTGG - Intergenic
1104503251 12:129305992-129306014 CTGAGCTCTGAGATTTGAAGTGG - Intronic
1104568531 12:129904885-129904907 CTTCCCTCTGAGCTTTGATGGGG - Intergenic
1104712027 12:130993996-130994018 CTGGCCACTGAGATGTGAGGGGG - Intronic
1104937606 12:132374904-132374926 CTGCCCGCTGAGCTGTGAGGAGG - Intergenic
1105557702 13:21461705-21461727 GTGCCCTCTGAAACTTGTAGGGG + Intergenic
1108173127 13:47764356-47764378 CTGCTCTCAGAAACTTCAGGAGG - Intergenic
1111190654 13:84802363-84802385 AAGGCATCTGAGACTTGAGGAGG - Intergenic
1111467389 13:88632724-88632746 CTGCCTTCATAGAATTGAGGAGG - Intergenic
1111572602 13:90106877-90106899 CTTACACCTGAGACTTGAGGAGG + Intergenic
1113592925 13:111513268-111513290 CTGCCCTCAGAGGCAAGAGGTGG - Intergenic
1114639973 14:24213173-24213195 CTTCCCTCTGAGAGTGGGGGAGG + Intronic
1115078399 14:29419480-29419502 TTATCCTCAGAGACTTGAGGAGG + Intergenic
1116888889 14:50248387-50248409 CTGCCCTCTAAGACTTCAGCTGG + Intronic
1120795939 14:88632834-88632856 CTGGACTCTGAGACTTCAGTAGG + Intronic
1121521951 14:94592143-94592165 CTAGCCTCTGAGAGTTCAGGCGG - Exonic
1122818046 14:104323692-104323714 CCGCCCTCTGAGACGTGCCGTGG + Intergenic
1123473179 15:20569565-20569587 CTGCCCTCTGATTTTAGAGGTGG + Intergenic
1123644827 15:22430788-22430810 CTGCCCTCTGATTTTAGAGGTGG - Intergenic
1123733480 15:23164576-23164598 CTGCCCTCTGATTTTAGAGGTGG + Intergenic
1123751610 15:23361951-23361973 CTGCCCTCTGATTTTAGAGGTGG + Intronic
1124212723 15:27776617-27776639 CTGTCCTCTGAGGCCTGCGGAGG + Intronic
1124283983 15:28385876-28385898 CTGCCCTCTGATTTTAGAGGTGG + Intronic
1124298714 15:28525738-28525760 CTGCCCTCTGATTTTAGAGGTGG - Intronic
1129460059 15:75696104-75696126 CTGCCCTCTGAGCCAGGAGAAGG + Intronic
1130183030 15:81651183-81651205 CTGCCCTTTCTGACTTGGGGTGG + Intergenic
1132376349 15:101330579-101330601 CTCACCCCTGAGACTTGAGGGGG + Intronic
1133852414 16:9517750-9517772 CAGCCCTCTGAGTCTTAAAGGGG + Intergenic
1135181000 16:20274442-20274464 CTGCCCTGTGAGAAATCAGGTGG + Intergenic
1141442838 16:84040577-84040599 CTGCCCTCTGTGGCTTGAGATGG + Intronic
1143054926 17:4155696-4155718 CTGGTCTCTGAGACTCCAGGAGG + Intronic
1143263460 17:5617619-5617641 CTGCCTTCTGGCATTTGAGGGGG + Intronic
1144452033 17:15389139-15389161 CTGGCCACTGAGACATGAGTGGG + Intergenic
1144823534 17:18092006-18092028 CTGCCCTCTGAGACTGGGCAGGG + Intronic
1145106656 17:20123510-20123532 CTGTCCTCTCTGACATGAGGAGG + Intronic
1145106660 17:20123541-20123563 CTGTCCTCTCTGACATGAGGAGG + Intronic
1147236187 17:39059263-39059285 CTGCCCTTTTGGCCTTGAGGAGG + Intergenic
1149538570 17:57451677-57451699 CTGCTGTCTGAGATTTAAGGTGG + Intronic
1151359367 17:73579334-73579356 CTGCCCTCTGCAACTTTATGGGG + Intronic
1151840458 17:76613830-76613852 CTGCCCACTGAGACCTGATGTGG - Intergenic
1154044849 18:10895045-10895067 CAGCCCACTGAGGCTTCAGGGGG - Intronic
1157391610 18:47307948-47307970 GTGGCCTCTAAGACTTAAGGTGG - Intergenic
1160186266 18:76678905-76678927 CTGGCTTCTGAGACTTGATGTGG - Intergenic
1161326945 19:3668598-3668620 CTGGCCTCGGAGCCCTGAGGTGG + Intronic
1162806113 19:13138796-13138818 CAGCCCCTTGGGACTTGAGGGGG + Exonic
1163425760 19:17240319-17240341 CTGGCCTCTGAGGCTGGAGTCGG + Intronic
1163836160 19:19575605-19575627 CTGCCCTTTGTGACCTGCGGAGG + Intronic
1164452596 19:28379893-28379915 CTGGACTCAGAGACTTGAGGGGG - Intergenic
1166008640 19:39925203-39925225 CCTCCCTCTGAGGCCTGAGGCGG - Intronic
1166453528 19:42920610-42920632 CTGCCCTATGGGACTTGTGCTGG + Intronic
1167050360 19:47074329-47074351 CTGCCCTCTTGGAGTTGATGGGG - Intronic
1168093339 19:54100226-54100248 CTGCCTACTGAGACAGGAGGAGG - Intronic
925487733 2:4354696-4354718 CTGCCCTGTGAGAATGGAGCCGG + Intergenic
925782858 2:7398930-7398952 CAGCTCTGTGAGACTTGATGAGG - Intergenic
926714647 2:15914577-15914599 CAGCCCTATGAGACTGGCGGAGG - Intergenic
928309511 2:30197791-30197813 CTCCCGCCTGAGTCTTGAGGGGG - Intergenic
930232779 2:48859551-48859573 CTGCCCTCTATGAATTGGGGTGG - Intergenic
930814340 2:55576837-55576859 CTCCCCTTTGAGATTTGATGAGG + Intronic
940808776 2:158219380-158219402 CTGCTCTCTGAAAATGGAGGTGG + Intronic
945190095 2:207179164-207179186 CTGCCCTCTGAGATCTGATGGGG - Intergenic
947634763 2:231674356-231674378 CTTCCCTCTGAGAGTGGAAGTGG + Intergenic
948132026 2:235608001-235608023 CTGCTGTCTCAGACATGAGGTGG + Intronic
948809852 2:240468956-240468978 CGGGCCTCTGGGACTTGCGGAGG - Intergenic
1170418512 20:16169508-16169530 GTGCACTCTTAGCCTTGAGGAGG + Intergenic
1170815215 20:19708279-19708301 CTGCCCTCAGGGAGTTAAGGGGG - Intronic
1171398734 20:24857898-24857920 CTGCCCTCTGAGTCCTTGGGAGG - Intergenic
1175278775 20:57788763-57788785 CTGCCCTCTGTGACTTCACTCGG + Intergenic
1179893496 21:44349542-44349564 CTGCCCTCTGATGCCTGAGAAGG - Intergenic
1180034300 21:45235716-45235738 CTGTCCTGTGTGAATTGAGGCGG + Intergenic
1183377543 22:37473902-37473924 CTGCCCTCTGACACTGTAGATGG - Intronic
1183428347 22:37751409-37751431 CTGCCCTCTGAGCTCTCAGGGGG + Intronic
1184383204 22:44159431-44159453 CTGGCCTGCGAGGCTTGAGGAGG + Intronic
1185204195 22:49528502-49528524 AGGCCCTGTGAGACTTGAGCAGG + Intronic
949411157 3:3766057-3766079 CTTCCCTCTGAGCCTTAGGGGGG - Intronic
950171771 3:10843834-10843856 CTGCCCTGCCAAACTTGAGGGGG - Intronic
950967723 3:17157546-17157568 CTGCCCTGTGTGTCTGGAGGAGG - Intronic
951717739 3:25666191-25666213 CTGCATTCTGAGTCTAGAGGTGG + Intergenic
954649669 3:52153569-52153591 CTGCCCACTGAGCCTAGGGGCGG - Intronic
954800912 3:53186459-53186481 CTGCCCTGGGAGGCATGAGGGGG - Intronic
955114933 3:55988550-55988572 CTGCCTTCTGAGAGAGGAGGGGG + Intronic
957356306 3:79091909-79091931 TTACCCTCTGATACCTGAGGTGG - Intronic
959277810 3:104299618-104299640 CTAACCTCTGAGCCTTCAGGGGG - Intergenic
961043853 3:123695353-123695375 CTGCCCTCTGAGAGCTGGTGTGG - Intronic
961530146 3:127535712-127535734 TTGCCCTCAGAGGCTTCAGGGGG - Intergenic
962166831 3:133058399-133058421 CTCCCGTCTGAGGCTTGAAGAGG - Intronic
962265057 3:133938857-133938879 CTGCCCTCTGCTTCTTGAAGGGG - Intronic
967292814 3:187937768-187937790 TTGCCATCTGAGACTCGAAGGGG - Intergenic
967826166 3:193879369-193879391 CTGCCCACTGAGACTAGGAGGGG + Intergenic
968235123 3:197026846-197026868 CAGCCCTCTGGGGCTTGGGGTGG - Intronic
968509664 4:989932-989954 CTGGGCTCTGGGACCTGAGGGGG + Exonic
968850708 4:3075514-3075536 CTTCCCTCTCAGACTAGAAGAGG - Intronic
969521029 4:7677880-7677902 CTGCCCTCTGAGCCTCTAGGAGG + Intronic
969703226 4:8779077-8779099 CTGGCCTCTGAGCGATGAGGAGG + Intergenic
976120338 4:81773746-81773768 CTGGCCAATGAGACCTGAGGGGG - Intronic
977228236 4:94419831-94419853 CATTCCTCTGTGACTTGAGGAGG - Intergenic
979205954 4:118038251-118038273 CTGCCCTATATGACTTAAGGGGG - Intronic
979996946 4:127442744-127442766 CTTCCCTCTGCCACTTAAGGAGG + Intergenic
981096903 4:140791541-140791563 CTGCCTTCTGAGTCTTGGGGGGG - Intergenic
983251915 4:165355111-165355133 TTTCCCTCAGAGACTTGAGAAGG - Intergenic
988459836 5:31424695-31424717 CTGACTTCTGGGACTAGAGGAGG - Intronic
988658382 5:33237515-33237537 CTAACCTCTGAGCCTTCAGGAGG - Intergenic
989946460 5:50237602-50237624 GTGCGCTCTGAGACTTATGGTGG - Intergenic
990448357 5:55913852-55913874 TTGCCATCTGAGACTGGAGTTGG + Intronic
992557256 5:77915950-77915972 CTGCCTGCTGAGAGTTGGGGAGG + Intergenic
997194201 5:131966812-131966834 CTGCTCTGTGACACTTGATGGGG + Intronic
997849572 5:137319086-137319108 CTGCCCTCAGAGAAAAGAGGAGG + Intronic
1000132960 5:158317740-158317762 CTGCCCGGTGAGGCTTGAGGTGG + Intergenic
1000612082 5:163385446-163385468 ATTCCCTCTGAGACTTGAGAGGG - Intergenic
1001818718 5:174693128-174693150 CTTCGCCCTGAGACTTGAGGGGG - Intergenic
1005422185 6:25663302-25663324 CTGCCCTTTGAGACTAAGGGTGG - Intronic
1005716432 6:28553746-28553768 CTGCTCTATGATACTGGAGGTGG + Intergenic
1005952754 6:30643577-30643599 CTGCCCTGGGAGACCTGGGGTGG + Intronic
1007193086 6:40036604-40036626 CTGGACACTCAGACTTGAGGTGG - Intergenic
1007311303 6:40948018-40948040 CTGCACTCTGAGACTAGACTGGG + Intergenic
1011873811 6:91930743-91930765 CTGCCCTCAGAGACCAGAAGGGG + Intergenic
1015847037 6:137531623-137531645 CTAACCTCTGAGCCTTCAGGGGG - Intergenic
1017905448 6:158754910-158754932 CTGCCCTCTGAGAAATGAAGCGG - Intronic
1019146899 6:169981424-169981446 CTGCTCACTGAGGCTGGAGGGGG + Intergenic
1021813112 7:24423199-24423221 ATGCCCTCTGTGTCTTGAGACGG + Intergenic
1026150746 7:67786200-67786222 CTCCCCTCTGCCAATTGAGGTGG - Intergenic
1029456137 7:100673526-100673548 CCCCCCTCTGGGACTGGAGGAGG - Exonic
1031026774 7:116687810-116687832 CTGCATTTTGAGACTAGAGGGGG + Intronic
1032197837 7:129799570-129799592 CTGCCCTCAGAGACATGGGTAGG + Intergenic
1034267545 7:149788548-149788570 CTGCACTCTGTGACCTCAGGAGG + Intergenic
1037595231 8:20349237-20349259 CTGAACTCTGAGAATTGAGCAGG - Intergenic
1039591861 8:38756773-38756795 CTGCCTCCTGAGACTAGGGGAGG - Intronic
1040018527 8:42719981-42720003 CTGCCTTCAGATCCTTGAGGAGG - Intronic
1040723865 8:50357236-50357258 CTGCCCTCTGAGAGTCGTGGAGG - Intronic
1044967583 8:97587990-97588012 CTGGCCTCAGAGAGGTGAGGAGG + Intergenic
1045052093 8:98336666-98336688 CAGCCCTCTGAGACACGTGGAGG + Intergenic
1048509545 8:135049886-135049908 CTGACCACTGAGAAATGAGGGGG - Intergenic
1049623998 8:143612030-143612052 CTCCCCTCTGAGAATGGACGGGG + Intergenic
1049709569 8:144057513-144057535 CTCCCCGCTGAGCCTGGAGGAGG - Exonic
1052546560 9:29888496-29888518 CTGCCCTCTGTGGCTTCATGTGG - Intergenic
1053396967 9:37784435-37784457 CTGCCCTCTGAGACTCCAAACGG + Intronic
1054740935 9:68805179-68805201 GAGCCCTCTGACACTTGAGAGGG + Intronic
1056243953 9:84675768-84675790 TTGCCATTTGAGGCTTGAGGTGG - Intronic
1057040229 9:91842687-91842709 CTGCCCTCTGATTCCAGAGGTGG - Intronic
1058643861 9:107112419-107112441 CTGAGCTCTGAGCCTTGCGGTGG - Intergenic
1059592162 9:115673330-115673352 CTGCCCTCTGAGATCAGAGGTGG + Intergenic
1059597165 9:115733634-115733656 GTGCCCTCTGAGGATTGGGGTGG - Intergenic
1061212363 9:129201273-129201295 CTCACCTCAGAGACTTGACGGGG + Intergenic
1061638928 9:131936228-131936250 CTGTCCTCAGAGACAAGAGGAGG + Intronic
1187049301 X:15680113-15680135 CAGCCCTGTGAGACTAGATGAGG + Intergenic
1189556813 X:42153564-42153586 CTGCCCCCTGAGGTTTGAGTGGG - Intergenic
1199642502 X:149877218-149877240 CTTTACTCTGAGAATTGAGGTGG + Intergenic
1200067725 X:153512192-153512214 CTGCCTCCTGAGACTAGAGCTGG - Intergenic
1201900695 Y:19044183-19044205 CTGCCCTCTCAGAATTGATTCGG + Intergenic