ID: 907832523

View in Genome Browser
Species Human (GRCh38)
Location 1:58078548-58078570
Sequence TTGTTTGAGCAGAGGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907832523_907832530 21 Left 907832523 1:58078548-58078570 CCCTGCAGCCTCTGCTCAAACAA No data
Right 907832530 1:58078592-58078614 GAAATAGGATGAGAAAGAAAAGG 0: 1
1: 3
2: 20
3: 177
4: 1526
907832523_907832529 6 Left 907832523 1:58078548-58078570 CCCTGCAGCCTCTGCTCAAACAA No data
Right 907832529 1:58078577-58078599 GGGCAAGAATCACTGGAAATAGG 0: 1
1: 0
2: 0
3: 29
4: 509
907832523_907832528 -1 Left 907832523 1:58078548-58078570 CCCTGCAGCCTCTGCTCAAACAA No data
Right 907832528 1:58078570-58078592 AAACAGAGGGCAAGAATCACTGG 0: 1
1: 0
2: 2
3: 28
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907832523 Original CRISPR TTGTTTGAGCAGAGGCTGCA GGG (reversed) Intronic
No off target data available for this crispr