ID: 907832528

View in Genome Browser
Species Human (GRCh38)
Location 1:58078570-58078592
Sequence AAACAGAGGGCAAGAATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 292}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907832523_907832528 -1 Left 907832523 1:58078548-58078570 CCCTGCAGCCTCTGCTCAAACAA No data
Right 907832528 1:58078570-58078592 AAACAGAGGGCAAGAATCACTGG 0: 1
1: 0
2: 2
3: 28
4: 292
907832524_907832528 -2 Left 907832524 1:58078549-58078571 CCTGCAGCCTCTGCTCAAACAAA 0: 1
1: 0
2: 1
3: 24
4: 284
Right 907832528 1:58078570-58078592 AAACAGAGGGCAAGAATCACTGG 0: 1
1: 0
2: 2
3: 28
4: 292
907832525_907832528 -9 Left 907832525 1:58078556-58078578 CCTCTGCTCAAACAAAACAGAGG 0: 1
1: 0
2: 29
3: 360
4: 1260
Right 907832528 1:58078570-58078592 AAACAGAGGGCAAGAATCACTGG 0: 1
1: 0
2: 2
3: 28
4: 292
907832521_907832528 22 Left 907832521 1:58078525-58078547 CCTAAAGTCCTATGATGTTAGCT No data
Right 907832528 1:58078570-58078592 AAACAGAGGGCAAGAATCACTGG 0: 1
1: 0
2: 2
3: 28
4: 292
907832522_907832528 14 Left 907832522 1:58078533-58078555 CCTATGATGTTAGCTCCCTGCAG 0: 1
1: 0
2: 1
3: 17
4: 135
Right 907832528 1:58078570-58078592 AAACAGAGGGCAAGAATCACTGG 0: 1
1: 0
2: 2
3: 28
4: 292
907832519_907832528 30 Left 907832519 1:58078517-58078539 CCCTTGAGCCTAAAGTCCTATGA No data
Right 907832528 1:58078570-58078592 AAACAGAGGGCAAGAATCACTGG 0: 1
1: 0
2: 2
3: 28
4: 292
907832520_907832528 29 Left 907832520 1:58078518-58078540 CCTTGAGCCTAAAGTCCTATGAT 0: 1
1: 0
2: 0
3: 17
4: 85
Right 907832528 1:58078570-58078592 AAACAGAGGGCAAGAATCACTGG 0: 1
1: 0
2: 2
3: 28
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907832528 Original CRISPR AAACAGAGGGCAAGAATCAC TGG Intronic
900850401 1:5138098-5138120 AAACAGTGGAGAAGAATCAGCGG - Intergenic
901322215 1:8346654-8346676 AAGCACAGGGAAAGAATCACTGG - Intergenic
903062407 1:20678948-20678970 AAACAGGGGGCAAAAATCTTGGG - Intronic
904072265 1:27810373-27810395 AAATAGAGGGCAAAAATAAGGGG + Intronic
904111472 1:28129555-28129577 GAACAGAGGGCAAGAAGAATGGG + Intergenic
904116399 1:28164984-28165006 AAACAGAGACTCAGAATCACAGG - Intronic
904118569 1:28180019-28180041 AAACAGAGGGCCAGGCTCAGTGG + Intronic
905342164 1:37286765-37286787 AAACAGAGGCCAAGCCTCCCAGG + Intergenic
905425434 1:37879967-37879989 AAACATAGGGAAAAAGTCACAGG + Intronic
907137246 1:52151472-52151494 AGACACAGGACAAGATTCACAGG - Intronic
907256684 1:53184581-53184603 AAGCTGAGGATAAGAATCACTGG + Intergenic
907832528 1:58078570-58078592 AAACAGAGGGCAAGAATCACTGG + Intronic
908090672 1:60682234-60682256 AAACATGAGGCAAGAATAACTGG - Intergenic
909193781 1:72589820-72589842 AAAAAGAAGGGAAGAATCAGAGG - Intergenic
910062582 1:83111540-83111562 AATCAGTGGGCAGGAATCAGTGG + Intergenic
910385252 1:86675517-86675539 TACCAGGAGGCAAGAATCACTGG - Intergenic
911198708 1:95022036-95022058 AACAAGAGAGCAAAAATCACAGG + Intronic
911764537 1:101657590-101657612 CAACAGAGAGCAAGGATCTCAGG + Intergenic
911824468 1:102463722-102463744 AATCAGAGGGCAAGAATTCTTGG + Intergenic
913510912 1:119561268-119561290 AAACAAAGGGCAAGACTGATGGG - Intergenic
913515133 1:119598674-119598696 AAACAAAGGGCAAGACTGATGGG - Intergenic
913537056 1:119783132-119783154 AAACAAAGGGCATGACTCACTGG - Intergenic
914404896 1:147360727-147360749 AATCAGTGCGCAAAAATCACAGG + Intergenic
917518482 1:175728582-175728604 AAGCAGAAGGCAAGAACCAAAGG - Intronic
917873907 1:179267671-179267693 AAACAGAAGGCAGGAATCACTGG + Intergenic
918022404 1:180708211-180708233 AAACAGTAGGCAAAAACCACTGG - Intronic
918557430 1:185819575-185819597 AAAAAGACCGCAAGAATAACTGG - Intronic
920106995 1:203560771-203560793 AAACAGAGTGCTAGCTTCACCGG - Intergenic
921375012 1:214464662-214464684 AAGCACAGGGCAAGAATGCCTGG - Exonic
921839581 1:219814194-219814216 AAACAGATGACTAGAATCATCGG + Intronic
921914484 1:220592087-220592109 CATCAGAAGGCAAGAATCATGGG - Intronic
922034769 1:221837664-221837686 AAACAGAGGGGAAAAGTCAATGG - Intergenic
922555913 1:226531778-226531800 AAGCAGAGGGGAAGAAGCAAGGG + Intergenic
922938457 1:229439081-229439103 AAAAAAAGGTCAAGAAACACTGG + Intergenic
923291152 1:232547465-232547487 AATCACAGGGGCAGAATCACAGG + Intronic
923624807 1:235605473-235605495 AAATAGAAGGCAGGAATCACGGG - Intronic
924475952 1:244382029-244382051 TACCAGGGGGCAAGAATCACTGG + Intronic
1063585228 10:7346366-7346388 AAACAGAGGACATGAAACAGAGG + Intronic
1066474215 10:35728960-35728982 AAACAAAGAGCAAGAATAAGTGG - Intergenic
1067083459 10:43226152-43226174 AAACAGAGGGCCAGGTTCAGTGG + Intronic
1067546016 10:47193178-47193200 AAACAGAGGGCAGGAGGCCCTGG + Intergenic
1068934290 10:62621230-62621252 AAACAGAGGTCAATAACCTCGGG + Intronic
1069310613 10:67031071-67031093 AAACAGAAGTCAAGTATGACGGG - Intronic
1069564667 10:69455505-69455527 AAAGAGAGGGAAAGAAAGACTGG - Intronic
1070645455 10:78199076-78199098 AAGCAGAGAGCCATAATCACAGG - Intergenic
1072824794 10:98596429-98596451 AAACATAGGGTAAAAATCACTGG - Intronic
1073736494 10:106353542-106353564 CAACAGGAGGGAAGAATCACTGG - Intergenic
1073811554 10:107157731-107157753 AAACAGTTGGCAAGAAGCAAAGG - Intronic
1073871701 10:107871979-107872001 AATCAGAGGGTGAGAATCAGAGG + Intergenic
1073960860 10:108926032-108926054 AAAGAGAGGGCAAGAGACAAGGG - Intergenic
1073988564 10:109237881-109237903 AAACAGAAGACAAGCATCACCGG + Intergenic
1074534542 10:114319512-114319534 AGGCAGCAGGCAAGAATCACTGG + Intronic
1075151147 10:119933365-119933387 AAACAGTGTGCAAGAACCAAGGG - Intronic
1076226342 10:128779213-128779235 AACCAGAGGACAAGAGGCACTGG - Intergenic
1076457956 10:130615964-130615986 AAACAGTGGGCAAAAACCAGGGG - Intergenic
1076845412 10:133066960-133066982 CAACAGAGGGAAAGGAACACAGG + Intergenic
1078585648 11:12585955-12585977 TAACAGAGGGCAGCAACCACAGG + Intergenic
1079107758 11:17583543-17583565 AAAAATAGGGCTACAATCACTGG - Intronic
1079733985 11:23972348-23972370 CACCAGAGGGCAAGAATCTTGGG + Intergenic
1081184584 11:40026408-40026430 AAAATGAGGGCAAGAATGAGAGG + Intergenic
1083778440 11:64906060-64906082 AAACAGAAGTCCAGAGTCACTGG + Intronic
1084369015 11:68725913-68725935 CAACAGAGGGCAAAATTCAGAGG + Intronic
1084586138 11:70063827-70063849 AAAGAGAGAGCAAGATTCAGAGG - Intergenic
1085250584 11:75141026-75141048 AAACTGAGTGCAAGAGTCTCAGG - Intronic
1085670004 11:78454443-78454465 AAACAGAGAGCAAGAAAGAAGGG - Intronic
1085772746 11:79339665-79339687 AATCCTAGGGCAAGAGTCACAGG + Intronic
1086452116 11:86927186-86927208 AGTCAGAGGGAAAGAATCAAGGG + Intronic
1086668276 11:89512799-89512821 AATCAGTGGGCAAGAACCACAGG - Intergenic
1087383358 11:97437750-97437772 AAACAGAGGGCCAGAATCTCTGG - Intergenic
1087551271 11:99653109-99653131 AAAAATAGGGCAATAATGACAGG + Intronic
1089113020 11:116072091-116072113 AAGCTGAGGGGAAGAATAACGGG - Intergenic
1089487295 11:118856502-118856524 AAAGAGATGTCAAGAATAACTGG + Intergenic
1090397442 11:126428447-126428469 AAACAGTCTGCAAGAAACACAGG - Intronic
1091847969 12:3672097-3672119 AAGCTGAGGACAAGTATCACTGG - Intronic
1092247996 12:6873838-6873860 AAACAGTGACCCAGAATCACAGG - Intronic
1092875962 12:12848287-12848309 AAACAGAGAACAAAAATCTCAGG - Intergenic
1094455085 12:30622976-30622998 CAAGAGATAGCAAGAATCACAGG + Intergenic
1098467344 12:70802721-70802743 AAACAAAGAGAAAGAATCCCTGG - Intronic
1099892610 12:88608409-88608431 AATCAGTGTGCAAAAATCACAGG + Intergenic
1102324455 12:111967857-111967879 CAACAAAGGGCAATAATCTCAGG + Intronic
1103244701 12:119446623-119446645 AGACAGAGAGAATGAATCACAGG + Intronic
1103751758 12:123168870-123168892 AAACTGAGGGAAAGAGTGACTGG - Intronic
1104283970 12:127406091-127406113 CAAGAGAGGACAAGAATCAATGG + Intergenic
1107412370 13:40169870-40169892 AAACAGAGGGAGAGAAAGACAGG - Intergenic
1107571109 13:41659079-41659101 AAACTGAGGGTAAAGATCACTGG + Intronic
1108064278 13:46561947-46561969 AAACATAGGGAAAGTATCAGAGG - Intronic
1110813076 13:79831819-79831841 AGACAGCGTGCAAGAAACACTGG + Intergenic
1111313674 13:86522708-86522730 ATACAGAGGGGAACAAGCACTGG + Intergenic
1112596036 13:100807871-100807893 AAACAAAGGGAAAAAAACACTGG - Intergenic
1113005517 13:105697599-105697621 AGACAGAGGGCAGGAGTCAGTGG - Intergenic
1116105617 14:40500250-40500272 AATCACAAAGCAAGAATCACAGG + Intergenic
1116123661 14:40754137-40754159 AATCAGTGTGCAAAAATCACTGG - Intergenic
1117732641 14:58739179-58739201 AAACAGAGAAAAAGAATCTCAGG - Intergenic
1118150256 14:63181376-63181398 CAACAAAGATCAAGAATCACTGG + Intergenic
1118983682 14:70735253-70735275 AACCAGAGGCCTAGAAGCACTGG + Intronic
1119626139 14:76177867-76177889 AAAGAGAGGGAGAGAATAACAGG - Intronic
1121100698 14:91248225-91248247 AAAAAGAAGGGAAGAATCTCGGG - Intronic
1121176937 14:91897500-91897522 CAACACAGGAGAAGAATCACTGG + Intronic
1121215750 14:92246362-92246384 AACCAGGAGGCAGGAATCACTGG + Intergenic
1122744763 14:103891185-103891207 AACCAGAGGGCAAGAAAGGCAGG - Intergenic
1123769183 15:23511515-23511537 AAACAGAGGGCGAGAAACCCTGG + Intergenic
1124149779 15:27167228-27167250 AAAGAGAGGAAAAGAATCAGGGG - Intronic
1124224492 15:27880684-27880706 AAACAATGTGCAAGAATCACAGG - Intronic
1124697351 15:31875656-31875678 AAAAATAGGACAAGAAACACAGG - Intergenic
1125796329 15:42406664-42406686 AGAAAGAGGGCAAGAAACACAGG - Intronic
1129348926 15:74942758-74942780 AAACAGGGGGCATGAATCCTGGG + Intergenic
1130399230 15:83533697-83533719 ACCCAGAGGGCAAGAAACTCTGG - Intronic
1131386975 15:92015846-92015868 AAACAGGGGCCAAGAAGAACTGG + Intronic
1132347173 15:101115352-101115374 AAAGAGTGGGCAAGACTCAGGGG - Intergenic
1132463337 16:66350-66372 AAACTGAGGCCAGGAAACACAGG + Intronic
1134310429 16:13071255-13071277 AACCAGAGGGATAAAATCACAGG - Intronic
1134558727 16:15188846-15188868 AAACAGTGGGCAGGCATTACAGG + Intergenic
1134880834 16:17744269-17744291 AAACAGAGGGAGAGAGACACGGG + Intergenic
1134919258 16:18100447-18100469 AAACAGTGGGCAGGCATTACAGG + Intergenic
1135172364 16:20197051-20197073 AAACAGTGGCCTAGAATTACAGG + Intergenic
1137869675 16:51937919-51937941 GGACAGAGGGAAAGAATAACAGG + Intergenic
1140523930 16:75606316-75606338 TACCAGGAGGCAAGAATCACTGG - Intronic
1143082966 17:4395060-4395082 AGAGAGAGGGCAAGAGCCACTGG - Intergenic
1143284430 17:5778690-5778712 AAAGAAAAAGCAAGAATCACAGG + Intronic
1143800603 17:9376966-9376988 AAACTGAGGACCAGAAGCACAGG + Intronic
1144298408 17:13900608-13900630 AAACAGAGTGGAAAAATCCCTGG - Intergenic
1147451279 17:40506253-40506275 TACCAGAGGGCAAGACTCCCAGG + Intergenic
1148443229 17:47722446-47722468 AAACATAGGGGAACACTCACTGG + Intergenic
1148567760 17:48643612-48643634 AAGCAAAGGGCAAGCATCTCAGG - Intergenic
1149242583 17:54667681-54667703 AAACAGTGGTAAAGAAGCACTGG + Intergenic
1149397219 17:56257455-56257477 AAAAAGAGGGCAAATCTCACAGG + Intronic
1149544160 17:57490873-57490895 AAACAGAGGGGAAGAAAGAGAGG - Intronic
1150126566 17:62639360-62639382 AAACAAAGTGCAAGGATCACTGG + Intronic
1150291561 17:63985330-63985352 CAACAGAGGGCAGGAAGCCCTGG - Intergenic
1150935019 17:69625918-69625940 TACCAGAAGGCAAGGATCACTGG + Intergenic
1151515971 17:74596010-74596032 AAAATCAGGGCAAGAACCACTGG + Intergenic
1152058784 17:78052852-78052874 AACCAGAGGTCAAAAATCAGTGG + Intronic
1153063418 18:1017937-1017959 AATCAAAGCGCTAGAATCACAGG - Intergenic
1155109790 18:22702820-22702842 AAAGAGAAGGAAAGAATCTCAGG - Intergenic
1156199103 18:34809706-34809728 GAACACAGAGCAAGAATAACTGG + Intronic
1156512894 18:37655925-37655947 AAAGAAAGGACAAGAAACACAGG - Intergenic
1159286454 18:66359997-66360019 AAACAGAGGGATAGAATAAAAGG + Intergenic
1164787090 19:30942153-30942175 AAACAGAAGCAAAGAATCAATGG - Intergenic
1166398782 19:42462581-42462603 AATCAGAGGGCATGAAGAACAGG + Intergenic
1167716651 19:51146622-51146644 AAACAAAGGGCAAGAATGGGAGG - Intronic
927507419 2:23623420-23623442 AAACAGATGGTAACAATTACAGG - Intronic
928170799 2:29001921-29001943 AGGCACAGGGCAAGAAGCACTGG - Intronic
929384816 2:41394045-41394067 AAACCAAAGGCAAGAATTACAGG + Intergenic
931211652 2:60202754-60202776 AATCAATGTGCAAGAATCACAGG - Intergenic
932192168 2:69750314-69750336 AAACACACGGCAAGAATGAGCGG - Intronic
932445033 2:71775273-71775295 CAACAGAAGGCAAGAATGAAGGG - Intergenic
932890932 2:75597108-75597130 AAATAGAGTGAAAGAAACACTGG + Intergenic
933451903 2:82464572-82464594 AAACACTGGGCAATAATAACTGG + Intergenic
935382721 2:102468756-102468778 GAACAGATGACAAGAACCACAGG + Intergenic
937858510 2:126690228-126690250 GAACAGAGGACAAGAATCTGAGG - Intronic
937859011 2:126693837-126693859 GAACAGAGGACAAGAATCTGAGG - Intronic
938180336 2:129176593-129176615 GTACAGAGGGCAGGAATCAGGGG - Intergenic
938777590 2:134555486-134555508 AAACAGTGGACAAGAAACAAGGG + Intronic
941068135 2:160926296-160926318 AAACAGAGGGGAGAAATTACAGG - Intergenic
941974264 2:171386127-171386149 AATCAGTAGGCAAGAATCTCAGG + Intronic
942250067 2:174039900-174039922 TAACACAGGGAAAGAAGCACAGG + Intergenic
943527858 2:189040064-189040086 AAAGAGAGGGAGAGAAACACAGG + Intronic
943682521 2:190783179-190783201 AAACAGATTGCAAGAATTTCAGG - Intergenic
945615332 2:212059106-212059128 AATCAATGGGCAAAAATCACAGG + Intronic
949005684 2:241645834-241645856 CAACAGAGGGCAGGATTCTCGGG + Intronic
1169175503 20:3508600-3508622 ATACAGAGGGGATTAATCACCGG + Intronic
1170127907 20:12986090-12986112 AAAGAGAGGACAAAAATCCCAGG - Intergenic
1170697800 20:18675333-18675355 TACCAGGAGGCAAGAATCACTGG + Intronic
1170903729 20:20491542-20491564 AAAGAGAGGGAAAGCAGCACGGG + Intronic
1171034002 20:21702296-21702318 TAACAGAGGGCAGAAAACACAGG - Intergenic
1171105963 20:22432608-22432630 AAAGAGAGAACAAGAATCAAAGG + Intergenic
1173697911 20:45037152-45037174 AAAGAGAGAGCAAGAACCCCAGG + Intronic
1174739105 20:52994794-52994816 AAACAGAGGGAAGGAGACACAGG - Intronic
1175147174 20:56905744-56905766 TACCAGTGGGGAAGAATCACGGG - Intergenic
1175580372 20:60094324-60094346 GAACAGAGGGCAAGACTCTCAGG - Intergenic
1178287597 21:31338296-31338318 TGAGAGAGGGCAAGAATCACAGG - Intronic
1179206764 21:39288367-39288389 TGCCAGAAGGCAAGAATCACTGG + Intronic
1179532696 21:42030939-42030961 CAACAGAGGGAAAGAAGCAGAGG - Intergenic
1181775955 22:25160389-25160411 AGACACAGGGCAAGAGTAACAGG - Intronic
1181859604 22:25808060-25808082 AAACAGAGAGCAAAAGTCTCAGG - Intronic
1182070768 22:27462217-27462239 AGACAGAGGGAAAGAAACCCAGG + Intergenic
1182160252 22:28114417-28114439 AAACAGATGGCTAGAATCAAAGG + Intronic
1182974820 22:34613430-34613452 AATCAGTGTGCAAAAATCACAGG - Intergenic
1183518475 22:38282133-38282155 AAACAGAGGGCAAAAGGGACTGG + Intergenic
949184930 3:1179107-1179129 AAAGAGGGAGCAAGAATGACAGG + Intronic
949562018 3:5211947-5211969 AAACAGAGGGCAGGATTTCCAGG + Intronic
950388031 3:12675214-12675236 AGGGAGAGGCCAAGAATCACAGG - Intergenic
950664103 3:14484520-14484542 AATCAGAGGGAGAGAATCACAGG + Intronic
951088472 3:18542873-18542895 AAAGAGAAGAGAAGAATCACAGG + Intergenic
951272981 3:20650236-20650258 AAACAGAGGGAAAGATTGGCTGG - Intergenic
951862711 3:27271995-27272017 AACCAGAGAGCAAGAATCTAGGG - Intronic
951997528 3:28747782-28747804 GAAGAGAGGGAAAGAATGACAGG + Intergenic
953605847 3:44412707-44412729 GAACTGAGGGCAAGAAGCAAAGG - Intergenic
954200909 3:49022562-49022584 AAACTGAGGCCCAGAGTCACAGG + Intronic
954330411 3:49886972-49886994 AAACAGTGTGAAAGAATGACAGG - Intergenic
954473102 3:50716179-50716201 AAGCAGAGAGCAAGGAACACAGG - Intronic
956344955 3:68268486-68268508 AAAAAGAGGTCAAATATCACAGG - Intronic
956936719 3:74110154-74110176 AAACAGACAGAAAGAATAACTGG + Intergenic
957260993 3:77901032-77901054 AAACAAAGGGCAAAAATGATAGG + Intergenic
957604774 3:82382907-82382929 AAACAGTGGGGAGGAATCCCTGG - Intergenic
958174134 3:89973663-89973685 AAACAGAGAGAAAGAAAAACTGG - Intergenic
958442910 3:94178461-94178483 GAACAGAGGGGAAGACTCACGGG - Intergenic
958899505 3:99869253-99869275 ACACAGATGCAAAGAATCACAGG - Intronic
959134265 3:102397314-102397336 AAAGAGAGAGCAAGAAAAACAGG - Intronic
960674037 3:120177603-120177625 ATACACAGTGCAAGTATCACAGG + Intronic
960754052 3:120990123-120990145 AATCAATGGGCAAAAATCACAGG + Intronic
960755246 3:121004376-121004398 AATCAATGGGCAAAAATCACAGG - Intronic
963600591 3:147375113-147375135 AAACAAAGGGCAAGGAGCCCAGG - Intergenic
964773521 3:160250508-160250530 AAAGACAGGGCAAGAAACATTGG + Intronic
965447557 3:168794302-168794324 AAACAGAGGCCCAGAGTCAATGG + Intergenic
965468184 3:169058578-169058600 AACCAGGAGGCAAGGATCACTGG - Intergenic
965592938 3:170379466-170379488 AAAGGGGGGGCAAGACTCACTGG - Intronic
969896110 4:10306380-10306402 GAACAGAAGGCAAAAATCACTGG - Intergenic
970124998 4:12799293-12799315 TACCAGAAGGCAGGAATCACTGG - Intergenic
970755274 4:19418362-19418384 AATCAGTGTGCAAAAATCACAGG + Intergenic
970917850 4:21356481-21356503 AATCAGTGCGCAAAAATCACAGG + Intronic
971544336 4:27866567-27866589 GAAAAGAGGGGCAGAATCACAGG - Intergenic
973256866 4:48122341-48122363 AAACAAAAGCCAAGAATCTCTGG - Intronic
975588309 4:75973731-75973753 CAACGGAAGTCAAGAATCACAGG + Intronic
976434739 4:85004255-85004277 AAGCAGAGGGCAACTCTCACTGG + Intergenic
977523954 4:98122025-98122047 AATCAGTGTGCAAAAATCACAGG - Intronic
977719802 4:100225933-100225955 AACCATAGGGGAATAATCACAGG + Intergenic
979217490 4:118182898-118182920 AATCACAGGGCAAGGAGCACAGG - Intronic
979928778 4:126603113-126603135 TACCAGAAGGCAAGAATCACTGG - Intergenic
980091896 4:128451534-128451556 AACCAGAAGGCAGGAATCATTGG + Intergenic
980206917 4:129731874-129731896 AAATAGAGGCCAAGTGTCACAGG + Intergenic
981162654 4:141517231-141517253 TACCAGAAGGCAAGAATCACTGG + Intergenic
981565373 4:146096092-146096114 CAGCAGAGAGCAAGAATGACTGG + Intergenic
982861435 4:160455220-160455242 AAGCAGATGACAAGAAACACAGG + Intergenic
983058198 4:163124262-163124284 AAGCAGAGAGCAACCATCACCGG - Intronic
983336972 4:166408559-166408581 AAGCAGAGGAAAAGAAACACTGG + Intergenic
987418516 5:17690738-17690760 AAACAGAAAGCAGGAATCAAAGG + Intergenic
987675444 5:21067507-21067529 AGACAGAGCGGGAGAATCACTGG + Intergenic
987889286 5:23855186-23855208 AATCAGTGTGCAAAAATCACAGG - Intergenic
989198374 5:38738176-38738198 AGACTGAGGGCGTGAATCACTGG - Intergenic
990238432 5:53792844-53792866 CAAGAGAGGTCAAGAATCACTGG + Intergenic
990922613 5:60984223-60984245 AATCAATGGGCAAAAATCACAGG - Intronic
990998535 5:61758183-61758205 TACCAGAAGGCAAAAATCACTGG + Intergenic
991331912 5:65501464-65501486 AAACAGAGGGCCAGGAGCAGTGG - Intergenic
991630788 5:68654765-68654787 AAACAGAGCCCAAGAATTTCAGG + Intergenic
992017100 5:72586535-72586557 AACCAGGAGGCAAGAACCACTGG - Intergenic
995750696 5:115450633-115450655 AAACAGAGGGGAAGAAAGGCAGG - Intergenic
995812728 5:116126093-116126115 AATCAGTGTGCAAAAATCACAGG + Intronic
996820417 5:127620228-127620250 TACCAGCAGGCAAGAATCACTGG - Intergenic
996825041 5:127673336-127673358 AAACAGAGGACATGAATGCCTGG + Intergenic
998699860 5:144685630-144685652 AAACAGAGGACAAGACTCCAGGG - Intergenic
999677898 5:154023795-154023817 AAACAGAAGACAAAAAGCACTGG + Intronic
1001050165 5:168407851-168407873 AAAAAGGGGGGAAGAATCGCAGG - Intronic
1001515113 5:172350215-172350237 AAACAGAGGCCCAGAAACCCCGG - Intronic
1002820174 6:717425-717447 AAAAAGAGGGCAAGAACAATGGG + Intergenic
1004586795 6:17010491-17010513 AAACAGAAGGCAAGAGTCGGAGG - Intergenic
1009516328 6:64623403-64623425 AAACAGAGTCCCAGAACCACTGG - Intronic
1012558007 6:100540103-100540125 AAAAAGAGGGCAGGAATGATGGG + Intronic
1015829027 6:137347547-137347569 AAACCGAGGGCTGGAATCAGTGG - Intergenic
1016723309 6:147328155-147328177 AAAAAAAGGGCAAGAAGTACTGG - Intronic
1017073650 6:150599331-150599353 AAACGGAGGTAAAGAATAACCGG - Intergenic
1018390538 6:163337761-163337783 AGACAGGGGGGATGAATCACTGG + Intergenic
1019129275 6:169861791-169861813 AAATGGCGGGCAAGAAGCACAGG - Intergenic
1021477186 7:21075465-21075487 AAACAGAGGAGAAGACTGACTGG + Intergenic
1023165191 7:37336618-37336640 AAACAGGGAGGAAGAATCTCAGG + Intronic
1023381053 7:39609126-39609148 AAGCAGTGAGGAAGAATCACAGG + Intronic
1023452433 7:40302254-40302276 AAACAGGTGGGAAGAATAACAGG - Intronic
1023487120 7:40699216-40699238 TCACTGAGGGCAAGCATCACAGG - Intronic
1024090538 7:45936256-45936278 AACCAGAAGGCAGGAAACACAGG - Intergenic
1024548791 7:50543345-50543367 ACACAGAGGGCAGAAATCAGCGG - Intronic
1028910105 7:96198266-96198288 AACCAGAGGTCATGAATGACAGG + Intronic
1029888848 7:103905263-103905285 AAATAGAGGGCAGGAAGCAGTGG - Intronic
1030811422 7:113976996-113977018 TAACAGAGTAAAAGAATCACTGG - Intronic
1030831477 7:114227754-114227776 AAACAGAGGGCAAATACCAGTGG + Intronic
1030977555 7:116145394-116145416 GAACAGAGGAGAAAAATCACTGG + Intronic
1031316113 7:120259786-120259808 AAGCAGAAGGCAATACTCACAGG - Intergenic
1031719435 7:125152937-125152959 AAAGAGAGGACAAGAAACACAGG - Intergenic
1032295507 7:130634541-130634563 AATCAGTGTGCAAAAATCACAGG - Intronic
1032411725 7:131698553-131698575 AAACACAGGGCAACAAGCAATGG + Intergenic
1036251150 8:7163635-7163657 AATCAGTGTGCAAAAATCACAGG + Intergenic
1036702442 8:11022014-11022036 AAACAAAGGGGAAGAAACAAAGG + Intronic
1037109677 8:15150886-15150908 AATGAGAGGGCAAAAATCACTGG - Intronic
1037457272 8:19075747-19075769 AAACATACGGCATGAAACACTGG - Intronic
1038374206 8:27022102-27022124 AAACAGATGGCAAGGATGAAAGG + Intergenic
1038688301 8:29738545-29738567 AAACAGAGGTGAAGAACCAGGGG - Intergenic
1039442822 8:37607212-37607234 AGAGAGAGGGCAAGAATCAAAGG + Intergenic
1039618643 8:38976489-38976511 AAACAGAGGGCAAGAAAGTTAGG - Intronic
1040684580 8:49856664-49856686 AAACAGATGCCATGACTCACTGG + Intergenic
1042120509 8:65482697-65482719 CAACAAATGTCAAGAATCACAGG + Intergenic
1042469222 8:69164100-69164122 CAACAGAGGGAAAAAATCTCAGG - Intergenic
1042744133 8:72087251-72087273 CAACAGAGGGCATGAATCTCAGG - Intronic
1043970301 8:86520924-86520946 AAACAAAAAGGAAGAATCACTGG - Intronic
1044002046 8:86894719-86894741 AAACAGAGGAAAAAAATCAGTGG - Intronic
1044522344 8:93213286-93213308 AAAAAGAAGGCAAAAATCAAGGG + Intergenic
1045416594 8:101973654-101973676 AAACAGAGGGGAAGAGCCACAGG + Intronic
1045523054 8:102919990-102920012 CAACAGAGGGGCAGAAACACAGG + Intronic
1045655037 8:104377757-104377779 AATCAGAGGGAGAGAAACACAGG + Intronic
1047907958 8:129493002-129493024 AAACAAATGGCAAGAATAATTGG + Intergenic
1049651071 8:143770221-143770243 AAACAAAGGGCATGAACAACAGG - Intergenic
1050369945 9:4910486-4910508 AAGCAGAAGGGAAGAATCAGGGG - Intergenic
1050449085 9:5760944-5760966 AAACAGAAGGAAAGAATTTCAGG - Intronic
1051729442 9:20124836-20124858 AAACAGAGGGTAAGAATATTGGG + Intergenic
1052318854 9:27145256-27145278 AAAAAGGGGGCAAGAATCAAAGG + Intronic
1052458294 9:28729413-28729435 AAACAGAGGAAAAAAATCTCAGG + Intergenic
1052491199 9:29170346-29170368 AAACAAAAGGCAAAAATCACAGG + Intergenic
1053623276 9:39842492-39842514 AAACAGAGGGGAATCATGACAGG + Intergenic
1053891072 9:42693559-42693581 AAACAGAGGGGAATCATGACAGG + Intergenic
1054220626 9:62408204-62408226 AAACAGAGGGGAATCATGACAGG - Intergenic
1054230088 9:62500968-62500990 AAACAGAGGGGAATCATGACAGG + Intergenic
1056820112 9:89835304-89835326 ACAGGGAGGTCAAGAATCACAGG - Intergenic
1057614967 9:96581314-96581336 AAACAGAGGGCCAGACACAGCGG + Intronic
1058411236 9:104734771-104734793 AAACAGAAGGCAAAAATCGATGG + Intergenic
1058990594 9:110252410-110252432 AAATAAAGGGCAAAAATCAAAGG - Intronic
1059706031 9:116824231-116824253 TACCAGAAGGCAGGAATCACTGG - Intronic
1185739642 X:2520959-2520981 AACCAGAGGTCAAGAGTCTCTGG - Intergenic
1186658479 X:11642775-11642797 AAACTGAGGGCAAGGAACAGTGG + Intronic
1187292352 X:17967260-17967282 AAGCCAAGGGCAAGAATCACTGG - Intergenic
1187753544 X:22494582-22494604 AAAGAGAGAGAGAGAATCACAGG - Intergenic
1189203145 X:39215106-39215128 AAAGAGAAGTCAAGCATCACAGG - Intergenic
1189343586 X:40223159-40223181 ATACAGAGGGCAAGACTCTGTGG + Intergenic
1189972378 X:46431442-46431464 CAGCAGAGGCCAAGAATCAAGGG + Intergenic
1191005479 X:55706747-55706769 AATCAATGGGCAAAAATCACAGG + Intergenic
1191615973 X:63169366-63169388 ACACTGAGGCCAAGAATCAAAGG + Intergenic
1191620325 X:63209557-63209579 ACACTGAGGCCAAGAATCAAAGG - Intergenic
1195459174 X:105104255-105104277 AAACAGAGCACAATAATCAGTGG - Intronic
1195863004 X:109400990-109401012 AAAAAGAGGGCAAAACTCTCTGG + Intronic
1196770531 X:119289082-119289104 CACCAGGGGGCAGGAATCACGGG + Intergenic
1197038270 X:121904065-121904087 AGACGCAGGGCATGAATCACTGG - Intergenic
1197914046 X:131515107-131515129 AAACAAAAGGCAAGAATATCGGG - Intergenic
1199149628 X:144414981-144415003 AATCAAAGGGGAAGAATCAAAGG + Intergenic
1199243832 X:145579384-145579406 AAACAGAGGAGACGAATCTCAGG - Intergenic
1199941534 X:152632536-152632558 AAACAGAGGGGGATAAGCACAGG - Intergenic
1201913941 Y:19162307-19162329 AATCAAAGTGCAAAAATCACAGG + Intergenic