ID: 907832530

View in Genome Browser
Species Human (GRCh38)
Location 1:58078592-58078614
Sequence GAAATAGGATGAGAAAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1727
Summary {0: 1, 1: 3, 2: 20, 3: 177, 4: 1526}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907832525_907832530 13 Left 907832525 1:58078556-58078578 CCTCTGCTCAAACAAAACAGAGG 0: 1
1: 0
2: 29
3: 360
4: 1260
Right 907832530 1:58078592-58078614 GAAATAGGATGAGAAAGAAAAGG 0: 1
1: 3
2: 20
3: 177
4: 1526
907832523_907832530 21 Left 907832523 1:58078548-58078570 CCCTGCAGCCTCTGCTCAAACAA No data
Right 907832530 1:58078592-58078614 GAAATAGGATGAGAAAGAAAAGG 0: 1
1: 3
2: 20
3: 177
4: 1526
907832524_907832530 20 Left 907832524 1:58078549-58078571 CCTGCAGCCTCTGCTCAAACAAA 0: 1
1: 0
2: 1
3: 24
4: 284
Right 907832530 1:58078592-58078614 GAAATAGGATGAGAAAGAAAAGG 0: 1
1: 3
2: 20
3: 177
4: 1526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907832530 Original CRISPR GAAATAGGATGAGAAAGAAA AGG Intronic
900489031 1:2937133-2937155 TAAATTGAATGAGAAGGAAATGG - Intergenic
900704743 1:4073353-4073375 GGAGAAGGAGGAGAAAGAAAAGG + Intergenic
900856360 1:5188219-5188241 GAAGTAGGAAGAGAAAGAGGAGG + Intergenic
901432223 1:9223767-9223789 GGAAGAGGAAGAGAAAGAAGAGG - Intergenic
901502661 1:9662995-9663017 GCAATAGTTTGATAAAGAAATGG - Intronic
901842650 1:11963843-11963865 GAAAGAGGATGAGGAAGACGAGG - Intronic
901951735 1:12755100-12755122 GAACAAAGAAGAGAAAGAAAGGG + Intronic
902077222 1:13797024-13797046 GACATAGGATGGTAAAGAGAAGG - Intronic
902743816 1:18459589-18459611 GAAATAGAATGATGAATAAAGGG - Intergenic
902746545 1:18478496-18478518 GAAAGAGAAAAAGAAAGAAAGGG + Intergenic
902828275 1:18992502-18992524 GAGATAGGATAAGATGGAAAAGG - Intergenic
902850269 1:19149898-19149920 GAAAAAGAAAGAGAAAGGAAGGG + Intronic
902851888 1:19165036-19165058 GCAAGAGGAAGAGAAAGAAGGGG + Intronic
903571128 1:24306306-24306328 AGAATAGCTTGAGAAAGAAAAGG + Intergenic
903889689 1:26561208-26561230 GAAAGAGGATGAGAAGTCAAAGG - Intronic
904239208 1:29133203-29133225 GAAAGAAGAAAAGAAAGAAAAGG + Intergenic
904480643 1:30791315-30791337 GAAGGAGGAAGAGAAAGAGAGGG + Intergenic
904499349 1:30905230-30905252 GAAACAGGGTGAGGAAGGAACGG + Intronic
904521514 1:31099707-31099729 GAAAAAGGGAGAGAAAGGAAGGG - Intergenic
904686895 1:32266829-32266851 GAAGAAGGAGGAGAAAGAAAGGG - Intronic
905085790 1:35375126-35375148 GAAAGAAGATGAAGAAGAAAAGG - Intronic
905130396 1:35751276-35751298 GGAAGAGGAGGAGAAAGAAGAGG - Exonic
905143104 1:35864879-35864901 GAAAGAGGATGAGGAAGAGAAGG + Intergenic
905319081 1:37102999-37103021 GAAAGAAGAACAGAAAGAAAAGG + Intergenic
905680320 1:39865973-39865995 GGAAAAGGAAAAGAAAGAAAGGG + Intronic
905706810 1:40066452-40066474 AGAAAAGGAGGAGAAAGAAAGGG + Intronic
905761270 1:40559792-40559814 AAAATATGAGGACAAAGAAAAGG - Intergenic
906048808 1:42853729-42853751 GAAATAGGCTGATAAAGAAAGGG + Intergenic
906070888 1:43015636-43015658 GAAAAAAGATGAGAAAGACGGGG - Intergenic
906276026 1:44516647-44516669 GAAAGAGGAAGAGAAGGGAAAGG + Intronic
906328036 1:44860756-44860778 GAAATGGGAAGAGAAAAAATGGG + Intronic
906539591 1:46575032-46575054 AAAATAGGAGGAGAGGGAAAAGG + Intronic
906631138 1:47369503-47369525 GAAAAAAGATGAAACAGAAATGG - Intronic
906656046 1:47549058-47549080 GAAAAAGGATGAGGAAGAGGAGG - Intergenic
907217270 1:52875038-52875060 AAAATAGGATGAACCAGAAAAGG + Intronic
907832530 1:58078592-58078614 GAAATAGGATGAGAAAGAAAAGG + Intronic
907896597 1:58698528-58698550 AAAATAGGAAGAAAGAGAAAAGG + Intronic
907901464 1:58745289-58745311 GAGATAACATGAGTAAGAAATGG - Intergenic
907994720 1:59618353-59618375 GAAATAGGCTGAGAATGTCAAGG + Intronic
908396548 1:63730483-63730505 GAAAGAAAAGGAGAAAGAAAAGG - Intergenic
908563076 1:65326457-65326479 GAAATAGAATGATAAAGGGATGG + Intronic
908700243 1:66890821-66890843 AAAAGAGGAAGAGGAAGAAAAGG + Intronic
908854296 1:68407059-68407081 GGAAAAGGAGGAGAAACAAACGG - Intergenic
908898789 1:68931744-68931766 GAAATGAGATCAGAAAAAAAGGG + Intergenic
909220072 1:72946791-72946813 TTAATAGGAAGAGAAGGAAATGG - Intergenic
909253653 1:73390529-73390551 AAAAGAGGAAGAGGAAGAAAAGG - Intergenic
909289535 1:73864887-73864909 GATATATGAAAAGAAAGAAAAGG + Intergenic
909555421 1:76948449-76948471 GAAAGAGGAAGAGAGAGAGATGG + Intronic
909663276 1:78107100-78107122 GAAAAAGGTAGGGAAAGAAAGGG - Intronic
909799494 1:79788349-79788371 TAATTAGGATGAGAAAGATTTGG + Intergenic
909936778 1:81560696-81560718 GAAGAAGGAAGAGAAAGAAATGG + Intronic
910108043 1:83652754-83652776 GAAAGGAGATGAGAGAGAAAAGG + Intergenic
910157504 1:84235571-84235593 GAAATTGGAAAAGGAAGAAATGG - Exonic
910311731 1:85831752-85831774 GCAATAGCATGGGAAATAAAGGG + Intronic
910696290 1:90020433-90020455 GAATGTGGATGAGTAAGAAAAGG - Intronic
910859542 1:91730436-91730458 GAAAAAGAATGAGATAGAAAGGG - Intronic
910921751 1:92356098-92356120 TAAATTGGATGAGGAAAAAAAGG - Intronic
911067907 1:93808108-93808130 GAAAGAGAATCAGAGAGAAAGGG + Intronic
911421553 1:97647933-97647955 GAAGATGGATGAGAGAGAAAGGG - Intronic
911568115 1:99488817-99488839 GACAAAGGAGCAGAAAGAAATGG + Intergenic
911675291 1:100651896-100651918 GAAAGAGGATGGGCCAGAAATGG - Intergenic
911792639 1:102037818-102037840 GAAAAAGGAAGGGAAAGGAAGGG - Intergenic
911864570 1:103001605-103001627 GTAAAATAATGAGAAAGAAAAGG + Intronic
912070956 1:105808761-105808783 GTACTTTGATGAGAAAGAAAAGG + Intergenic
912523831 1:110266140-110266162 GAAATAGGGGGAGAAATAATGGG + Intronic
912597159 1:110890585-110890607 GAAAGAGAAAGAGAAAGGAAAGG + Intronic
912648253 1:111415380-111415402 TTAATAGGATGAGAATGAAGTGG - Intronic
912662346 1:111543623-111543645 GGAATAGGAGGAGGAAGAGAAGG + Intronic
912662351 1:111543647-111543669 GGAATAGGAGGAGGAAGAAGAGG + Intronic
912688200 1:111783610-111783632 GGAAGAGAAAGAGAAAGAAATGG + Intronic
912945110 1:114078278-114078300 GAAAGAGAAAGAGAAAGGAAAGG + Intergenic
913167382 1:116200553-116200575 GAAAAAGAAAGAGAGAGAAATGG - Intergenic
913303818 1:117402011-117402033 GATCTGGAATGAGAAAGAAAAGG - Intronic
913433410 1:118820984-118821006 GCTATAGCATCAGAAAGAAAAGG - Intergenic
913568624 1:120098401-120098423 GAAATAGGAACAGAGAGAAAGGG - Intergenic
914289438 1:146259422-146259444 GAAATAGGAACAGAGAGAAAGGG - Intergenic
914550474 1:148710175-148710197 GAAATAGGAACAGAGAGAAAGGG - Intergenic
914962898 1:152222119-152222141 GAAGTAGGAAGAGAAAGAGAAGG + Intronic
915027083 1:152841263-152841285 GAAAGAGAAGGAGAGAGAAAAGG + Intergenic
915064758 1:153215669-153215691 GAAAAAGGAGGAGAAAAAGAAGG + Intergenic
915193036 1:154168005-154168027 GAAAAAGGAAGAGGAAAAAAAGG + Intronic
916057281 1:161076485-161076507 GAAGTGGGAGGAGAAAGAATGGG + Intronic
916065130 1:161130620-161130642 GAGATAGGAGGTGAAAGAGAAGG - Intronic
916166080 1:161968528-161968550 GCAATAGGATGAAAAGAAAAGGG - Intergenic
916598984 1:166274083-166274105 GCAATAGGAGGAGAGTGAAAAGG - Intergenic
916608803 1:166369647-166369669 GGAAGAGAATGAGAAAGAAAGGG - Intergenic
916680996 1:167105078-167105100 GAAGGAGGAGGGGAAAGAAAGGG - Intronic
916765775 1:167859081-167859103 GGATCAGGATGAGGAAGAAAGGG + Intronic
916908628 1:169318764-169318786 TATATAGAATGAGAAAAAAAGGG + Intronic
917092249 1:171365039-171365061 GAAATATCATGAGAATGAACAGG + Intergenic
917378318 1:174375357-174375379 GAAATAAGAACAGAAATAAATGG + Intronic
917437526 1:175036193-175036215 GAGAAATGATGTGAAAGAAAAGG - Intergenic
918113176 1:181476011-181476033 GTAAGAGGAAGAGAAGGAAACGG + Intronic
918454609 1:184695993-184696015 GAAAGAGGATCAGAGAGACAGGG - Intronic
918547461 1:185701045-185701067 GAAAAAGGAGGAGCAACAAATGG - Intergenic
918628475 1:186686141-186686163 AAAATAGGAGCAGAAAGTAAGGG + Intergenic
918943587 1:191031694-191031716 GAAATAAGATGGGACACAAATGG + Intergenic
918984923 1:191612772-191612794 AAAGAAGGAAGAGAAAGAAAAGG + Intergenic
919107785 1:193175381-193175403 GCAATAGCAAGAGAAAGAAGTGG + Intronic
919503701 1:198371003-198371025 CAAAAAGTATCAGAAAGAAATGG - Intergenic
919694728 1:200562789-200562811 GAAATAGGATGACTAAAACAAGG - Intronic
919862491 1:201749912-201749934 GAAAAAAGAAAAGAAAGAAAAGG + Intronic
920256155 1:204655894-204655916 GAAAAAAGAAGAGAAGGAAAGGG - Intronic
920296274 1:204959079-204959101 GAAAAAGGAAGAAAATGAAAAGG - Intronic
920538487 1:206758579-206758601 GAAATAGGAGGTGAAAAAATGGG - Intergenic
920649918 1:207829539-207829561 TGAATAGGATGAGCAAGAACTGG + Intergenic
920682465 1:208083477-208083499 AAGGCAGGATGAGAAAGAAAAGG - Intronic
920713138 1:208314525-208314547 AAAAGAGGATGAGAAAGAATTGG + Intergenic
920797225 1:209151660-209151682 GAAATGTGATGAGATAAAAAGGG + Intergenic
920838406 1:209533526-209533548 GAGAAAGGAAGAGAAAGAGAAGG + Intergenic
920940291 1:210475597-210475619 GAAAAAGAAAGAGAAAGAAGAGG - Intronic
921169154 1:212530509-212530531 GAGAGAGGGAGAGAAAGAAATGG + Intergenic
921214536 1:212925849-212925871 GAGAAAGAAAGAGAAAGAAAAGG + Intergenic
921215053 1:212929455-212929477 TAAAAAGGAAAAGAAAGAAAAGG + Intergenic
921378354 1:214497926-214497948 GAAACACAATGAGAGAGAAAAGG + Intronic
921383396 1:214547348-214547370 GAAACAGGATGGCAAAGAATTGG - Intronic
921738884 1:218660671-218660693 GAAATAGAATCAAAAGGAAAGGG - Intergenic
921894083 1:220380688-220380710 AAAAGAGAAAGAGAAAGAAATGG + Intergenic
921954074 1:220963781-220963803 GAAGTGCAATGAGAAAGAAATGG - Intergenic
922009398 1:221566411-221566433 GAAAGAGAATGAGAAAGAGAGGG + Intergenic
922174813 1:223189104-223189126 GATACAGGGTGAGAAGGAAAGGG - Intergenic
922433296 1:225577553-225577575 GAAATAGAATAATAAATAAAAGG + Intronic
922639538 1:227214393-227214415 TAAAATGGATGAGAAAGAAAAGG + Intronic
922860074 1:228809037-228809059 GGAAGAGAATGAGAAAGAAAAGG + Intergenic
923097758 1:230789017-230789039 GAAAGAGGAGGAAAGAGAAATGG - Intronic
923099622 1:230801999-230802021 GGAATAAGATGAGGAGGAAAAGG + Intronic
923186875 1:231582472-231582494 GAAATGAGATTAGAAAGACATGG - Intronic
923582282 1:235229254-235229276 GGAAGATGATGAAAAAGAAAAGG - Exonic
923598392 1:235379172-235379194 GAAAGTAGATGAGAATGAAAGGG - Intronic
923647608 1:235839899-235839921 GAAATAATATGTGAAGGAAAGGG - Intronic
923673272 1:236059638-236059660 GAAATAGAAATAGAAACAAAAGG + Intronic
923778272 1:236998935-236998957 GAAAAAGGAAGACAGAGAAAGGG + Intergenic
924074840 1:240323141-240323163 GAAAGAGAAAGAGAAAGGAAAGG - Intronic
924195833 1:241605987-241606009 GAAAAAGGAGGAGGAGGAAAAGG - Intronic
924200247 1:241651053-241651075 GAAAAAGGAGGAGAAACAAATGG + Intronic
924318876 1:242827259-242827281 TATATATAATGAGAAAGAAATGG - Intergenic
924846186 1:247774871-247774893 GAAAGAGAATGAGAGAGAGAGGG - Intergenic
1062786918 10:272386-272408 GAAATAGGTAGAAATAGAAAGGG - Intergenic
1063023736 10:2156624-2156646 GAAAAAGAAAGAGAGAGAAAAGG + Intergenic
1063228056 10:4034483-4034505 GAAATAGGCTGAGAAAAATTAGG - Intergenic
1063416479 10:5876865-5876887 AAAAAAGGAAAAGAAAGAAAAGG + Intronic
1063584292 10:7337532-7337554 GAAAGAGGAAGAGAGAGAAGGGG - Intronic
1063607007 10:7531428-7531450 CAAAAAGGATGAGAAGGAAGAGG + Intergenic
1063653647 10:7965187-7965209 GAAAGAGAAAGAGAAAGACAAGG + Exonic
1063828902 10:9930431-9930453 CAAATAGGATGAGAGTGAGAGGG + Intergenic
1063847052 10:10141919-10141941 AAGATAGAGTGAGAAAGAAAGGG + Intergenic
1064135065 10:12743375-12743397 GAAAAAGGAAAAGAAAGACAAGG + Intronic
1064232805 10:13544302-13544324 AGAATAGGAAGAGAAAGAAGGGG + Intergenic
1064305150 10:14158755-14158777 GGAAGAGGATGAGGAAGAAGAGG + Intronic
1064625510 10:17257639-17257661 GAAATAGGGAGAGAAAGAGAAGG + Intergenic
1064629915 10:17299293-17299315 GAGAAAGAAAGAGAAAGAAAAGG + Intergenic
1065239531 10:23692195-23692217 GAAAAAAGAGGGGAAAGAAAAGG - Intergenic
1065348552 10:24773493-24773515 GAAAAAGGAAGAAAGAGAAAAGG - Intergenic
1065635239 10:27725887-27725909 TACATAGGAGAAGAAAGAAAAGG + Intronic
1065692926 10:28353876-28353898 GGAGTAGGCTAAGAAAGAAACGG - Intergenic
1065813700 10:29465200-29465222 AAGATAGAAAGAGAAAGAAAGGG - Intronic
1065819136 10:29509293-29509315 GAAAGAGGGGGAGAGAGAAAGGG + Intronic
1065886681 10:30084077-30084099 GAAAGAGTGAGAGAAAGAAAGGG + Intronic
1066054206 10:31665165-31665187 GAAATTAGATGACAAAGAACAGG - Intergenic
1066263538 10:33752596-33752618 GAAGGAGGATGAGGAAGAGAAGG - Intergenic
1066334627 10:34463200-34463222 GAAAGGGGAAGGGAAAGAAAAGG + Intronic
1067023724 10:42825765-42825787 GCAATCAGATGAGAAAAAAAAGG - Intronic
1067306638 10:45070862-45070884 GAAAAAGGAAAAGAAAGACAAGG - Intergenic
1067416565 10:46107037-46107059 GAGATGAGAGGAGAAAGAAACGG - Intergenic
1067681415 10:48443839-48443861 GAAACAGAAATAGAAAGAAAAGG - Intergenic
1067919728 10:50441398-50441420 AAAATTGGACGAGAAAAAAAAGG + Intronic
1068080122 10:52309555-52309577 GAAAGAGAGAGAGAAAGAAAGGG + Intergenic
1068173992 10:53433405-53433427 GAGAAAGAAAGAGAAAGAAAGGG + Intergenic
1068177756 10:53484482-53484504 GAAACAAGAGGACAAAGAAAAGG - Intergenic
1068262432 10:54600096-54600118 GAAAAAGGAAGAGAAACCAATGG + Intronic
1068362074 10:55988821-55988843 GAGAGAGAATGAGAGAGAAAGGG + Intergenic
1068451934 10:57201776-57201798 AAAAGAGGATGAGAAAGAAAAGG - Intergenic
1068604052 10:58986079-58986101 GAAACAGAATGAAAAATAAATGG + Intergenic
1068756378 10:60658895-60658917 GAAAAAGGAAAGGAAAGAAAAGG + Intronic
1068801397 10:61144673-61144695 CAACTAGGATGAGAGACAAAAGG - Intergenic
1068949432 10:62762262-62762284 AAAATAGGAGGGGAAAGAGAAGG + Intergenic
1069118548 10:64538817-64538839 GATATGGTATGAGACAGAAATGG - Intergenic
1069271725 10:66536725-66536747 GTAACATGATGAGAAAAAAATGG + Intronic
1069479813 10:68771292-68771314 GAAAGAGGACAAAAAAGAAAAGG + Exonic
1069731431 10:70617638-70617660 GAATGAAGAAGAGAAAGAAAGGG - Intergenic
1069871042 10:71533211-71533233 GAAACAGGATGAGAATCAAGGGG - Intronic
1070324457 10:75378795-75378817 GACATAGGATGTGACAGAAAGGG + Intergenic
1070512925 10:77177438-77177460 GAAAGAGGAAGGAAAAGAAAAGG - Intronic
1070560170 10:77560364-77560386 GTATTGGGTTGAGAAAGAAAAGG + Intronic
1070869719 10:79740176-79740198 GAAAGAGTAAGACAAAGAAAAGG - Intergenic
1071129733 10:82376786-82376808 GAGTGAGGATGAGAAGGAAAAGG - Intronic
1071267821 10:83979914-83979936 GAATTAGAATGTGAAAGAAATGG - Intergenic
1071407272 10:85349747-85349769 GAAACAGAAAGAGAGAGAAAGGG + Intergenic
1071636638 10:87262386-87262408 GAAAGAGTAAGACAAAGAAAAGG - Intergenic
1071658611 10:87475568-87475590 GAAAGAGTAAGACAAAGAAAAGG + Intergenic
1072049092 10:91685850-91685872 GAAATAAAATAAGAAAAAAAGGG - Intergenic
1072273763 10:93802385-93802407 GAAAAAGGGTGAGAAAAAGAGGG + Intergenic
1072815645 10:98506431-98506453 GAAAGAAAAGGAGAAAGAAAGGG - Intronic
1072859765 10:98991026-98991048 GAAATGGTATGAGAAAAAAGTGG - Intronic
1073024875 10:100480563-100480585 GAAAGAGCCTGAGGAAGAAATGG - Intronic
1073060222 10:100729511-100729533 GAAAGAAGAGGAGAAAGAAGCGG - Intergenic
1073222640 10:101888682-101888704 GGAGTAGGATGAAAAGGAAAGGG + Intronic
1073622962 10:105067741-105067763 CAAGTAGGATGAGAAATTAAAGG - Intronic
1073651920 10:105370147-105370169 GAAATAGGACAGAAAAGAAAAGG - Intergenic
1073726627 10:106239608-106239630 GAAAAAGTAGGAGAAATAAAAGG - Intergenic
1073871797 10:107873094-107873116 GAAAGAGAATGAGTAACAAATGG - Intergenic
1073915384 10:108397105-108397127 GAAATAAGATCAGACAAAAAGGG + Intergenic
1074289064 10:112124613-112124635 GGAAGAGGAGGAGAAAGAAGGGG - Intergenic
1074363958 10:112843409-112843431 TATATAGGATGAGCAGGAAAAGG + Intergenic
1074676487 10:115857000-115857022 GAAGGAGGAGGAGAAGGAAAAGG - Intronic
1074691131 10:116005061-116005083 GAAACAGGAGGAGAAGGAGATGG - Intergenic
1074764959 10:116693925-116693947 AAAATATGATGATAAAAAAATGG - Intronic
1074865492 10:117542342-117542364 GAAAGAGGAGGAGGAAGAAGAGG + Intergenic
1075245016 10:120813350-120813372 GAAATATGATTGGACAGAAAAGG - Intergenic
1075420498 10:122296995-122297017 GAAAGAGGAGGAAAAAGAACAGG - Intronic
1075513914 10:123094430-123094452 GAGAGAGGAAGAGAAAGAGAGGG - Intergenic
1075564173 10:123491734-123491756 GAAGTAGGATGTAAAAGGAATGG + Intergenic
1076628371 10:131835835-131835857 AAAAAAGAATGAGAAAAAAATGG + Intergenic
1077388606 11:2288324-2288346 GAAAGAGGGTGATAAAGCAATGG + Intergenic
1077789846 11:5426745-5426767 GAAAGGGGATGAGAAAAACAGGG - Intronic
1077841168 11:5976222-5976244 GAAAAAGGATTAGAAGAAAAAGG + Intergenic
1078211634 11:9274701-9274723 GAAAGAGAGAGAGAAAGAAAGGG + Intergenic
1078314477 11:10281588-10281610 GTAAGAGGATGTAAAAGAAAAGG - Intronic
1078633718 11:13029819-13029841 GAAGTAGGAAAAGAAGGAAAAGG + Intergenic
1078679225 11:13460064-13460086 GAAATAGGAAATGAAAGAAGAGG - Intronic
1078867408 11:15310943-15310965 TAAATCTGATGAAAAAGAAAAGG - Intergenic
1078868351 11:15320231-15320253 TAAATGGGATGAAGAAGAAAGGG - Intergenic
1079513046 11:21233412-21233434 GAAATAAAAAGAGAAGGAAAAGG - Intronic
1079528254 11:21416461-21416483 GGAAAATGAGGAGAAAGAAATGG + Intronic
1079535584 11:21511445-21511467 GATGTTGGATGAGAAAGATAAGG + Intronic
1079869346 11:25777651-25777673 GGAAGAGAATGAGAAAGAACAGG - Intergenic
1080063110 11:27978964-27978986 GAGAGAGGAAGAGAATGAAAAGG + Intergenic
1080216313 11:29845398-29845420 TAATTAGGATGGGATAGAAAAGG - Intergenic
1080303604 11:30813009-30813031 GAAGAAGGAAGAGAAAGGAAGGG - Intergenic
1080379813 11:31756660-31756682 AACATTGGTTGAGAAAGAAAAGG + Intronic
1080614898 11:33937310-33937332 AAAATATGAAGAGAAAGAACTGG + Intergenic
1080680783 11:34473877-34473899 GGACTAGGTTAAGAAAGAAATGG - Intergenic
1080936601 11:36870207-36870229 AAAATAAAAAGAGAAAGAAATGG - Intergenic
1080982099 11:37420375-37420397 GAAAAAGGGTGCTAAAGAAATGG - Intergenic
1080988232 11:37497399-37497421 AAAAAAGAAAGAGAAAGAAAAGG + Intergenic
1081015834 11:37878786-37878808 GAGATGGTATGATAAAGAAAAGG - Intergenic
1081227482 11:40542018-40542040 GAAAGAGAAAGAGAAAGGAAAGG - Intronic
1081352738 11:42074330-42074352 TAAAGAGAATGAGAAAAAAATGG + Intergenic
1081514367 11:43811092-43811114 GCAAAAGGAAGAGAAAGAACAGG - Intronic
1082920894 11:58492657-58492679 GAAAGAGAAAGAGAGAGAAAGGG - Intergenic
1083020187 11:59498926-59498948 GAAATAGGATTGGACAAAAAAGG + Intergenic
1083411829 11:62499172-62499194 GAAAGAGGAAAAGATAGAAAGGG + Intronic
1083577168 11:63800621-63800643 GAAAAAGAAGGAGAAAGAAAAGG + Intergenic
1083577186 11:63800710-63800732 GAAAAAGAAAAAGAAAGAAAGGG + Intergenic
1084439655 11:69165444-69165466 GGAAGAGGAGGAGAAAGAGAAGG - Intergenic
1084560093 11:69899968-69899990 GAAAGAGGAAGAAAGAGAAAGGG + Intergenic
1084566564 11:69931941-69931963 GAAATAGAATCAGATGGAAATGG - Intergenic
1084729305 11:71063075-71063097 GAAAGAGAAAGAGAAAGACAGGG + Intronic
1084851085 11:71941328-71941350 GAATTAGGGAGAGAAATAAAGGG - Intronic
1085062629 11:73461565-73461587 TAAATAGGATGAGCAGGAGATGG + Intronic
1085113509 11:73909663-73909685 AGAAAAGGATGAGGAAGAAAAGG - Intronic
1085262461 11:75214997-75215019 AAAACAGGCTCAGAAAGAAAGGG - Intergenic
1085835975 11:79956817-79956839 GAAATTGGAGAAGAAAAAAATGG + Intergenic
1086210622 11:84313691-84313713 GAAAGAGGATACGAAAGGAAAGG + Intronic
1086271536 11:85073193-85073215 CAAACAGGGTGAGAAAGAAGAGG - Intronic
1086367888 11:86126215-86126237 GAAATATGAAGAAAAAAAAAAGG - Intergenic
1086442665 11:86844596-86844618 GAAATAGAGGCAGAAAGAAATGG - Intronic
1087086613 11:94225651-94225673 GAAAAAGGAGGAGAAAGATAAGG + Intergenic
1087805897 11:102555065-102555087 GAAAAAGGATCAGAGAGACAGGG - Intergenic
1087814427 11:102642807-102642829 AAAGTAAAATGAGAAAGAAAGGG + Intergenic
1088055819 11:105575908-105575930 GAAATAATGTGAGAAAGCAAAGG + Intergenic
1088134545 11:106538484-106538506 GAGAGAGGATGAGAAAGGGAGGG - Intergenic
1088192363 11:107240180-107240202 GTAATCAGATGAGAAGGAAATGG + Intergenic
1088735005 11:112721321-112721343 CAAGAAGGAGGAGAAAGAAAAGG + Intergenic
1089033635 11:115361108-115361130 GAAAGAGGTTGCTAAAGAAATGG + Intronic
1089083577 11:115798014-115798036 GAAATGGGCTGAGAAAGAGTTGG + Intergenic
1089124667 11:116168319-116168341 GACTTAGCATGAGAAGGAAAGGG - Intergenic
1089148183 11:116345565-116345587 GCAGTAGGATGAGAGAGAAGAGG - Intergenic
1089215314 11:116831171-116831193 GAAATAGAAAGAGAAAGAAAGGG - Intronic
1089571126 11:119410660-119410682 GACATCTGTTGAGAAAGAAAAGG - Intergenic
1089577971 11:119460131-119460153 GGATTAGGATGAGGAGGAAAAGG + Intergenic
1089705535 11:120275131-120275153 GGAATAGGGTGATAAAGAGATGG + Intronic
1089889148 11:121861979-121862001 TAAATTGGAGGAGATAGAAAAGG + Intergenic
1089912378 11:122114554-122114576 AAAAGAGAAAGAGAAAGAAAAGG - Intergenic
1089963230 11:122634564-122634586 GAAATAGAATGAGAAACAGATGG + Intergenic
1090186133 11:124740202-124740224 GACCTAGGAGCAGAAAGAAAAGG + Intronic
1090273033 11:125401120-125401142 GAAATAGGAAGAAAAATAAAGGG + Intronic
1090781415 11:130010251-130010273 GAAAGAGAAGGAGAAGGAAAAGG + Intergenic
1090929822 11:131286649-131286671 GAAATAGGCAGGGAAAAAAAGGG - Intergenic
1090943110 11:131405975-131405997 TAAATAGGGTGAAAGAGAAAGGG - Intronic
1090976242 11:131682925-131682947 GAAATGGGATGAGCTGGAAAAGG + Intronic
1091081369 11:132671810-132671832 GAAAGAGAAGGAGAGAGAAAAGG + Intronic
1091512561 12:1144061-1144083 GAAGTAGAAGGAGAAGGAAATGG - Intronic
1091609060 12:1987582-1987604 AAAATTGGATGAGAAATAAATGG - Intronic
1091703415 12:2678660-2678682 GAATAAGGATGAGGAAGAGACGG - Intronic
1091888735 12:4035824-4035846 AAAATGGGAAGAGAAAGAGAAGG - Intergenic
1092028238 12:5261240-5261262 GAAACAGGATGAGAAAGTCAGGG + Intergenic
1092034392 12:5318824-5318846 GAAACACGATGAAGAAGAAAAGG + Intergenic
1092071201 12:5632922-5632944 GAAATAGGATGTGACAGAATAGG - Intronic
1092079472 12:5703390-5703412 GGAACAGGGTGAGAAAGTAAGGG + Intronic
1092079669 12:5705317-5705339 GAAAAAAGGAGAGAAAGAAAAGG + Intronic
1092210674 12:6644408-6644430 GAAACAGGAAGAGCAAGAAGAGG - Exonic
1092354706 12:7784914-7784936 AAAATAGGAGGAAAAAAAAATGG - Intergenic
1092395830 12:8125487-8125509 GAAAGAGGAGGAGGAAGAAGAGG + Intronic
1092576903 12:9794683-9794705 GAAACAGAAAGAGAAAGAAATGG - Intergenic
1092755475 12:11759206-11759228 GAAATGTGAAGTGAAAGAAAAGG - Intronic
1092799930 12:12154379-12154401 GAAATATAAAGAGCAAGAAAGGG - Intronic
1093040030 12:14367499-14367521 GAAATAGCATGTGGTAGAAAGGG - Intronic
1093124931 12:15316664-15316686 GAAAGAGAGAGAGAAAGAAAAGG + Intronic
1093128245 12:15356534-15356556 GACATAGTATGAAAGAGAAATGG + Intronic
1093225370 12:16476836-16476858 GAAATAAGGTGAGAAAGAAGAGG + Intronic
1093299946 12:17441902-17441924 GGAATAGCATGAGAAAGACTGGG - Intergenic
1093431189 12:19086879-19086901 AAAATAGGATTACAAAGAAAAGG - Intergenic
1093454415 12:19350914-19350936 GGATTAGGATGAGAAAGAAAAGG - Intronic
1093768099 12:22988173-22988195 GAAAAAGAAAGAGGAAGAAAAGG - Intergenic
1093819131 12:23590516-23590538 GAAATAGGAGAATAAGGAAAAGG - Intronic
1094154301 12:27321618-27321640 AAAATAGGATGAGAAAGCCTTGG + Intronic
1094217410 12:27958575-27958597 AAAGAAGGAAGAGAAAGAAAAGG + Intronic
1094529299 12:31258526-31258548 GAAAAAGGATGAGAAGAAAATGG + Intergenic
1094626546 12:32129731-32129753 AAAAGAAGATGAGAAAGAAAAGG - Intronic
1095050821 12:37553136-37553158 GAAAAAGAAAGAAAAAGAAAAGG + Intergenic
1095144481 12:38709260-38709282 GCAAAAGGATAAGACAGAAAAGG - Intronic
1095154743 12:38838896-38838918 GAAAAGAGATGAGACAGAAAGGG - Intronic
1095202780 12:39404345-39404367 CAAATAAGATGAGAAAATAATGG + Intronic
1095257849 12:40061192-40061214 TAAATAAGCTGGGAAAGAAAAGG + Intronic
1095306479 12:40644699-40644721 GAAAAAAGAACAGAAAGAAAGGG - Intergenic
1095523560 12:43097323-43097345 GAAACTGGTTGAGAAAAAAAGGG - Intergenic
1095622278 12:44271897-44271919 CAAATAGACTGATAAAGAAATGG + Intronic
1095646241 12:44551526-44551548 GAGAGAGAATGAGAAATAAAAGG - Intronic
1095758855 12:45803971-45803993 GAAGTAGGATGAGTAACATATGG + Intronic
1095861033 12:46918270-46918292 AAAAAAGGATGAGGAGGAAATGG - Intergenic
1095922759 12:47547013-47547035 GAAGGAGGAGGAGGAAGAAAAGG + Intergenic
1096260464 12:50086937-50086959 GAATTAGGATGAGAAATCAAAGG + Intronic
1096563074 12:52451153-52451175 GAAAAAGATTTAGAAAGAAAAGG - Intronic
1096565226 12:52472813-52472835 GAAAAAGATTTAGAAAGAAAAGG - Intronic
1096764603 12:53873782-53873804 GAAATATGAAGAGAAAAATAAGG + Intergenic
1096803982 12:54129135-54129157 GAAAAAGGAAGGGAAAGAAAGGG + Intergenic
1097202736 12:57293325-57293347 GCAATACAAAGAGAAAGAAAAGG + Intronic
1097333106 12:58353801-58353823 AAAAGACGATGAGAAAGGAAAGG + Intergenic
1097552220 12:61088763-61088785 GAAAAAGGATGGGTAAGAAAAGG - Intergenic
1097639788 12:62166542-62166564 GGAAAAAGATGAGAAAAAAAGGG - Intronic
1098155387 12:67592488-67592510 GAAAAAAGAAAAGAAAGAAAAGG + Intergenic
1098253493 12:68592858-68592880 AAAACAGTATGAGAAACAAAAGG - Intergenic
1098269829 12:68759027-68759049 TAAATAAGATTAGAAAGAGAGGG - Intronic
1098495772 12:71133893-71133915 GAAATGGGAGGAAAAAAAAATGG + Intronic
1099086302 12:78250703-78250725 CTAAGAGGAAGAGAAAGAAAAGG + Intergenic
1099137209 12:78920728-78920750 GAAACATGAAGGGAAAGAAAGGG - Intronic
1099249654 12:80237593-80237615 GGAGTAGGTTGAGCAAGAAAAGG + Intronic
1099772199 12:87075556-87075578 GAGATAGGTAGAGAAAGACAGGG + Intergenic
1099894341 12:88625900-88625922 GAGTCAGGCTGAGAAAGAAAAGG + Intergenic
1099979974 12:89587411-89587433 AAAATTAGCTGAGAAAGAAAGGG - Intergenic
1100102804 12:91130116-91130138 AAAAAAGAAAGAGAAAGAAAGGG - Intergenic
1100303708 12:93331341-93331363 GAAAAAGAAAGAAAAAGAAAGGG + Intergenic
1100853124 12:98734210-98734232 AAAAGAGGATGAGAGAGACAAGG - Intronic
1101172037 12:102107448-102107470 GGAAAAGGAGGCGAAAGAAAAGG + Intronic
1101582360 12:106053193-106053215 GGGACAGGATGAGAAAGCAAAGG - Intergenic
1102327019 12:111994777-111994799 GAAACAGGATGTGAAACAACCGG + Intronic
1102359316 12:112270184-112270206 TAAATAAGATGATAGAGAAAAGG - Intronic
1102703579 12:114861989-114862011 GAAATGGGAAGAAAAAGGAATGG - Intergenic
1102709131 12:114909911-114909933 GGAAGAGGATAACAAAGAAAGGG - Intergenic
1102717487 12:114986678-114986700 GGAAAGGGAAGAGAAAGAAAGGG - Intergenic
1102866170 12:116376876-116376898 GAAATGTAATTAGAAAGAAATGG + Intergenic
1103018673 12:117515950-117515972 GTAATAGGAGGAGACAGAGATGG + Intronic
1103098943 12:118155722-118155744 TAAATAAGATGAGAGAGAACAGG - Intronic
1103138771 12:118530574-118530596 GAAATAAGGAAAGAAAGAAAAGG + Intergenic
1103222474 12:119257358-119257380 GATACAGGAAAAGAAAGAAAAGG + Intergenic
1103270093 12:119666263-119666285 CAAATAGGAGCAGACAGAAAAGG - Intergenic
1103495288 12:121357427-121357449 AAAAGAGAAAGAGAAAGAAAGGG + Intronic
1103525160 12:121562680-121562702 GAAAGAGGAGGAGGAAGAGAGGG + Intronic
1103606712 12:122092058-122092080 GAAAAAGAAAGAAAAAGAAAGGG - Intronic
1104085143 12:125467382-125467404 GAAAAAGGAGGAGAAAGAGGAGG - Intronic
1104091462 12:125521251-125521273 GAAGGAGAATGAGAAAGAGAAGG - Intronic
1104225845 12:126832209-126832231 GAAATAGGAGGAGAGGGAAAGGG - Intergenic
1104232517 12:126898789-126898811 GAAGAAGGAGGAGAAAGAATGGG + Intergenic
1104275650 12:127324979-127325001 GAAAGAGGAGGAGACAGAAGAGG - Intergenic
1104297473 12:127530074-127530096 GCAAGAGGAAGAGAAAAAAAGGG + Intergenic
1104354669 12:128075019-128075041 GAAAAAGAAAAAGAAAGAAAAGG - Intergenic
1105759389 13:23499510-23499532 GACCTAGAAGGAGAAAGAAAGGG + Intergenic
1105967741 13:25399839-25399861 GAAAGAGGAGGGGGAAGAAAGGG - Intronic
1106017997 13:25887110-25887132 AACAGAGGATGAGTAAGAAATGG + Intronic
1106174743 13:27320617-27320639 GAAGGAAGAAGAGAAAGAAAAGG + Intergenic
1106184578 13:27397928-27397950 GACAAAGGATGAGCCAGAAAGGG + Intergenic
1106197395 13:27505776-27505798 GAAATAGGAGGAATATGAAAGGG - Intergenic
1106267084 13:28120147-28120169 TAAATTGGATGATAAGGAAAAGG + Intergenic
1106404137 13:29459021-29459043 GAAAGAGAAAGAGAAAGCAAAGG + Intronic
1106629615 13:31457262-31457284 GAAAGAGGATATTAAAGAAATGG - Intergenic
1106639899 13:31573065-31573087 GAGACTGGATGAGGAAGAAAAGG + Intergenic
1106649538 13:31675182-31675204 GCAATGGGAAGAGAAAGAAAAGG - Intergenic
1106836526 13:33641044-33641066 GAAATAGGACTAGACACAAAGGG + Intergenic
1106899256 13:34337734-34337756 GAAAGAGGAAGAGAAAGGGAAGG + Intergenic
1107169867 13:37328212-37328234 GACATAGGTTGAAAATGAAAGGG + Intergenic
1107355981 13:39567557-39567579 GAAATAGGAAGAGGAAGAAGAGG - Intronic
1107668586 13:42718679-42718701 GAAGAAGGAGGAGAAAGAAGAGG + Intergenic
1107691404 13:42957159-42957181 GATATGGGATGAGTAAGAAAAGG + Intronic
1107720896 13:43246837-43246859 GTGACAGGAAGAGAAAGAAAAGG + Intronic
1107846289 13:44516786-44516808 GAAATAGGAGGAGAAATGAAGGG - Intronic
1108378155 13:49832867-49832889 GAAATAGGATGAGAACCCAAAGG - Intergenic
1108491972 13:50991193-50991215 GAGAAAGGGTGAAAAAGAAAGGG + Intergenic
1108819197 13:54326000-54326022 GAAATCGTATTAGAAAGAAATGG - Intergenic
1109128466 13:58548803-58548825 ATAATAGGAAGAAAAAGAAACGG + Intergenic
1109129185 13:58559375-58559397 GAAAAAAGATGAGAAAAAAGTGG - Intergenic
1109169933 13:59082784-59082806 GAAAAAGGAGGAGAAAGAAAGGG + Intergenic
1109251765 13:60029191-60029213 GATGTAGGATGTGAATGAAAAGG - Intronic
1109291023 13:60475075-60475097 AAAATAGGAAGAAAAAAAAAAGG - Intronic
1109471308 13:62808367-62808389 CAAATAGGAGAGGAAAGAAAAGG + Intergenic
1109859048 13:68172900-68172922 GAAATGAAATGAGAAGGAAATGG + Intergenic
1109907096 13:68857251-68857273 GAAATAGGAAAATAGAGAAAGGG - Intergenic
1110075357 13:71234044-71234066 GGAGAAGGAGGAGAAAGAAAAGG + Intergenic
1110168421 13:72471393-72471415 GTAATAAGATGAGAAAGAAAGGG - Intergenic
1110216862 13:73033359-73033381 GAAATATGAAGACACAGAAAAGG - Intergenic
1110454356 13:75673458-75673480 CAAATAGGAAAAGAGAGAAAGGG - Intronic
1110500178 13:76218431-76218453 AAAATAAGATGATAAAGTAATGG - Intergenic
1110614067 13:77521645-77521667 GAAACAGGGTTAGAATGAAAAGG + Intergenic
1110797269 13:79653902-79653924 GAAATAAATTGAGTAAGAAATGG - Intergenic
1110816472 13:79865909-79865931 GGAAGAGGATGAGAGAGGAAGGG + Intergenic
1111098983 13:83555791-83555813 GAAAGAGGGAGAGAAAGAAAGGG + Intergenic
1111198195 13:84900270-84900292 GAGGTAGACTGAGAAAGAAAAGG - Intergenic
1111419381 13:87991449-87991471 AAAGTAGGAAGAGAAGGAAAAGG - Intergenic
1111573018 13:90112797-90112819 GAGAGAGGAAGAGAGAGAAAAGG + Intergenic
1111657942 13:91175497-91175519 GGAATGGGATAAGAAATAAAGGG - Intergenic
1111714481 13:91862962-91862984 GAAAGAGAAGGAGAAAGGAAAGG - Intronic
1111758714 13:92433786-92433808 GAAAAAGTAAGAGAAAGAAATGG + Intronic
1111799815 13:92967798-92967820 GACAAGGGATGAGAAAGAAAAGG + Intergenic
1111888758 13:94055333-94055355 AAGAAAGGAGGAGAAAGAAAAGG + Intronic
1112021074 13:95371805-95371827 GAAAAAGAATAAGAAAGAACAGG - Intergenic
1112782590 13:102917199-102917221 GAAAGAGGAAGAGAAAGGAAGGG - Intergenic
1112815935 13:103273467-103273489 GGAATAGGATAGGAAAGGAAAGG - Intergenic
1112837207 13:103530651-103530673 GAATTAGATTGAGAAAGCAAGGG + Intergenic
1112900604 13:104352689-104352711 GAAATGGTATGAGAATGAGATGG - Intergenic
1112920522 13:104605985-104606007 GGAAAAGAAGGAGAAAGAAAAGG + Intergenic
1113308422 13:109104506-109104528 GAAACAAGAGGAGAAGGAAAAGG + Intronic
1113799623 13:113079693-113079715 GAAACAGGATGGGAAGGAAGAGG + Intronic
1114761594 14:25322215-25322237 AAAAGAGGAGGAAAAAGAAAAGG - Intergenic
1115224581 14:31089413-31089435 GAAATAAAATGAGAAACCAAGGG + Intronic
1115396443 14:32914403-32914425 ATGATAGAATGAGAAAGAAAAGG - Intergenic
1115631199 14:35247316-35247338 AAAATAGTAAGAGAAAGGAAGGG - Intronic
1115707002 14:36009057-36009079 AGTATAGGATGAGAAAGAAAAGG + Intergenic
1115713037 14:36071572-36071594 GAAATAAGATGTAAATGAAATGG + Intergenic
1115748740 14:36466376-36466398 GGAGTTGGCTGAGAAAGAAAGGG - Intergenic
1115886181 14:37974419-37974441 AAAAAAGGAAGAAAAAGAAATGG - Intronic
1116344876 14:43780071-43780093 GAAATATGATAGGAAATAAAAGG + Intergenic
1116362275 14:44015000-44015022 GAAAGAGAAAGAAAAAGAAAAGG + Intergenic
1116578302 14:46604688-46604710 TAAATAGGGAGAGAAAGAGAGGG + Intergenic
1116707813 14:48325407-48325429 GAAAAAGAAAGAGAAAGGAAAGG + Intergenic
1117063103 14:51982764-51982786 AAAAGTGCATGAGAAAGAAAGGG - Intergenic
1117543896 14:56775092-56775114 GAAATGCAATGAAAAAGAAAAGG - Intergenic
1117851628 14:59977701-59977723 GAAAAAGTATGAAAAGGAAAAGG + Intronic
1117902179 14:60546143-60546165 GAAAGGGGAGGGGAAAGAAAGGG - Intergenic
1118117733 14:62799954-62799976 AGAAGAGGAGGAGAAAGAAAAGG + Intronic
1118335797 14:64852646-64852668 GAAATAGCAAGTGAGAGAAAGGG + Intronic
1118419758 14:65588974-65588996 TAAAGGGGCTGAGAAAGAAAAGG - Intronic
1118424740 14:65648300-65648322 GGAACAGGAAGAGGAAGAAAAGG - Intronic
1118549680 14:66936381-66936403 AAAAAAGAAAGAGAAAGAAATGG + Intronic
1118600307 14:67467408-67467430 GAAATAGGATGAAAGAGAAAAGG + Intronic
1118682285 14:68255131-68255153 GGAAAAGGAAGAGGAAGAAAAGG - Intronic
1119121196 14:72079169-72079191 GAAATAGGGGGAAAAAAAAAAGG - Intronic
1119202613 14:72768544-72768566 GAAATTGGATGAAGAAGATAGGG + Intronic
1119230606 14:72976475-72976497 GAAAAAGGAGGAGAAAAATAAGG + Intronic
1119394280 14:74314754-74314776 GAAATGTGATTAGACAGAAAGGG + Intronic
1119568571 14:75649781-75649803 GAGTTAGGAAGTGAAAGAAAAGG - Exonic
1119638857 14:76298687-76298709 AACATAGGATGAGTGAGAAATGG - Intergenic
1119972625 14:78988999-78989021 AAAATAACATGAGAAAGAAGTGG - Intronic
1119988115 14:79162970-79162992 AAAAAAGGAAGAGAAGGAAAGGG - Intronic
1119997658 14:79271406-79271428 GAAAGGGGAAGGGAAAGAAAGGG - Intronic
1120067305 14:80058062-80058084 GAAAGACGATGAGGAAGAAAAGG + Intergenic
1120366213 14:83573795-83573817 AAATTGGGATGAGAGAGAAAAGG + Intergenic
1120398166 14:83994733-83994755 TAAGTAGGTTGAGAAAGAATAGG - Intergenic
1120717537 14:87855864-87855886 GAAAGAGAAAAAGAAAGAAAGGG + Intronic
1120721531 14:87894309-87894331 GAACTAGGAGGAGATTGAAAAGG + Intronic
1121144211 14:91569453-91569475 GAAAAAGAAAGAGAAAGAAAAGG - Intergenic
1121178763 14:91911486-91911508 GAAGTAGGAGGAGGAAGAAGAGG + Intronic
1121492926 14:94372646-94372668 GAAATTGGAAGAGGAAGAAGTGG + Intergenic
1121594178 14:95146941-95146963 GAGAAAGGATAAGAAGGAAAAGG + Intronic
1121708429 14:96018587-96018609 GGAAAAGGAGGAGAAAGAGAAGG - Intergenic
1121929531 14:97959946-97959968 GCAAAAAGATGAGGAAGAAAAGG - Intronic
1122020122 14:98830940-98830962 GAAGAAGGATAAGAAAGGAAAGG + Intergenic
1122049961 14:99050185-99050207 AAAATAGTATGTGAAAGAAAAGG + Intergenic
1122233306 14:100318117-100318139 GAAAGAGGAAGATAAAGGAAAGG + Intergenic
1122563942 14:102637972-102637994 GAAATTGGAACAAAAAGAAATGG - Intronic
1123930101 15:25164323-25164345 GAAGTATTATGACAAAGAAAGGG - Intergenic
1124139858 15:27067640-27067662 GAAATGGGATGAGTCAGGAAAGG - Intronic
1124580366 15:30948508-30948530 GAAAAATGCTGAGAGAGAAAGGG + Intronic
1125770215 15:42160190-42160212 GATAAATGGTGAGAAAGAAAAGG + Exonic
1125772149 15:42175615-42175637 GTAATAGGAAAAGAAAGGAAAGG - Intronic
1125866794 15:43058675-43058697 GAAATAGAAAAAGAATGAAAAGG - Intronic
1126056540 15:44735248-44735270 GAAAGAGAAAGAGAAAGAAAGGG + Intronic
1126056544 15:44735331-44735353 GAAACAGAGAGAGAAAGAAAGGG + Intronic
1126604240 15:50459949-50459971 GAAAAAGAAGGAGAAAGCAAAGG - Intronic
1126851026 15:52797032-52797054 GAAAAAAGAAAAGAAAGAAAAGG - Intergenic
1126941896 15:53776569-53776591 AAAATAGGAAGAGAAATAATGGG - Intergenic
1127033166 15:54886676-54886698 GAAATCGGATGAGAAAGAAAGGG - Intergenic
1127271477 15:57405732-57405754 GAAAAAGGAAAAGAAAGAAAAGG - Intronic
1127446348 15:59067148-59067170 GGAAGAGGAAGAGAGAGAAAAGG - Intronic
1127506019 15:59598637-59598659 GAAAGAGAATCAGAAAGACAGGG + Intronic
1127522997 15:59761832-59761854 GAAAAAAGAAAAGAAAGAAAGGG - Intergenic
1128033465 15:64502079-64502101 GCAGCAGAATGAGAAAGAAAAGG + Intronic
1128180310 15:65597075-65597097 GAAAAAGGATGGGAAGGAAGTGG + Intronic
1128466237 15:67914926-67914948 GAAAAAGGAAAAGAAAGAGAGGG - Intergenic
1128478688 15:68019038-68019060 GAAAGAGAAAGAGAAAGAAAAGG + Intergenic
1129055412 15:72816605-72816627 GAAATAGGATTGTACAGAAAGGG + Intergenic
1129077114 15:73006732-73006754 GAAATAGGACCAGCAAGATAAGG - Intergenic
1129092867 15:73169941-73169963 GAAATAGGATGAGAGAAACAGGG + Intronic
1129383069 15:75179840-75179862 GAAAAGGGAGGGGAAAGAAAGGG - Intergenic
1129580338 15:76802318-76802340 AAAATAGGTTGGGAAAAAAAAGG - Intronic
1129788659 15:78325888-78325910 GAAATTGTATAATAAAGAAATGG - Intergenic
1129885906 15:79036752-79036774 GAGATAGCAAGAGAGAGAAAGGG + Intronic
1129888293 15:79054016-79054038 GAAATGGGCTGAGCTAGAAATGG - Intronic
1129984543 15:79906223-79906245 GAAAGAAGATGACTAAGAAAGGG + Intronic
1130010736 15:80151797-80151819 GAAATAGGAGAAGAGAGAGAGGG - Intergenic
1130575745 15:85091838-85091860 AAAATATGATGAGAAGGAAAAGG + Intronic
1130619245 15:85444372-85444394 GAACTAGGATGAGCAATAAAAGG + Intronic
1130688830 15:86062662-86062684 GAAAGAGGAGGAGGAAGAAGAGG - Intergenic
1130731211 15:86493946-86493968 TAAAGAGGATGAGAAAAGAAAGG - Intronic
1130849269 15:87777874-87777896 GAAATAAGATGGGGAAGAAAGGG + Intergenic
1131081384 15:89539172-89539194 GAGAAAGGAAGAGAAAGAGAAGG + Intergenic
1131699363 15:94917515-94917537 GAAAGAAGATGAGAAGGGAAGGG + Intergenic
1131726586 15:95232623-95232645 GAAAGAGGAGGAGAAATGAAAGG + Intergenic
1131847544 15:96503707-96503729 GGTATGGGATGAGTAAGAAATGG + Intergenic
1131898895 15:97066161-97066183 GAAATAGGAGGAGAATGAAGAGG - Intergenic
1132534141 16:468680-468702 GGAATAGAATGAGATAGAGAGGG + Intronic
1132755913 16:1485333-1485355 AAAAAAAGATAAGAAAGAAAGGG + Intergenic
1133191597 16:4137685-4137707 GAAAGAGAAAGAAAAAGAAAGGG + Intergenic
1133312729 16:4860757-4860779 GAAAGAGGCTCAGAAAAAAAGGG + Exonic
1133331281 16:4975986-4976008 GAATTTGGATGAGGAAGAACAGG + Intronic
1133619639 16:7513981-7514003 GAAGTAGAAAGAGAGAGAAAGGG - Intronic
1133640119 16:7708613-7708635 GAAATAGGGTGAATCAGAAAGGG - Intronic
1133692924 16:8233832-8233854 GAAAAAGGGGGAAAAAGAAAGGG - Intergenic
1133874764 16:9723302-9723324 GAAATAGGAAGAGAAGGAGGAGG + Intergenic
1134375219 16:13665921-13665943 GAAAAAGGAAGAGGAAGAAGAGG + Intergenic
1134507563 16:14820713-14820735 GAAACAGGAGGAGAAAGGAAGGG + Intronic
1134610265 16:15602630-15602652 GAAGGAAGAGGAGAAAGAAAAGG + Intronic
1134695261 16:16219475-16219497 GAAACAGGAGGAGAAAGGAAGGG + Intronic
1134895996 16:17887187-17887209 GAAATAGGATGGGACAAAAAGGG - Intergenic
1134976571 16:18575211-18575233 GAAACAGGAGGAGAAAGGAAGGG - Intergenic
1135022142 16:18971745-18971767 GAAAGAGGATCAGAAAGACAAGG - Intergenic
1135161733 16:20102526-20102548 GAAAAAGGAAGAGGAAGACAAGG - Intergenic
1135229107 16:20688351-20688373 GAAAAAGAAAGAGAAAGAAATGG + Intronic
1135667395 16:24347324-24347346 GAAAGAGAAGGAGAAAGAAAAGG + Intronic
1135667396 16:24347360-24347382 GAAAGAGAAAGAGAAAGAGAAGG + Intronic
1135860601 16:26052232-26052254 GAAATAGGATTGGACAAAAAGGG - Intronic
1135958807 16:26978913-26978935 GATAGAGGAAGAGAGAGAAAGGG - Intergenic
1135971390 16:27074418-27074440 CAAGCAGGATGGGAAAGAAAAGG + Intergenic
1136595790 16:31249025-31249047 GAAAAAGGAGGAGAAGTAAAAGG - Intergenic
1136859989 16:33692934-33692956 GCAATCAGATGAGAAAAAAAAGG + Intergenic
1136938430 16:34498678-34498700 GAAAAGGGAGGAGAAAGCAAGGG - Intergenic
1136961389 16:34849879-34849901 GAAAAGGGAGGAGAAAGCAAGGG + Intergenic
1138352739 16:56354742-56354764 GAAGTGGGATGAGACAGGAAGGG - Intronic
1138721894 16:59091814-59091836 GAGAATGGAAGAGAAAGAAATGG - Intergenic
1138894189 16:61183126-61183148 GAAATATGATTGGACAGAAAGGG + Intergenic
1138938404 16:61759382-61759404 GGAAGAGGAAGAGAAGGAAAAGG + Intronic
1139113149 16:63917164-63917186 GAATCAGTATGAGAAAGAACAGG - Intergenic
1139231368 16:65285523-65285545 GAGGTAGGAAGAGAAATAAAAGG - Intergenic
1139312733 16:66040915-66040937 GAAAGGGGAGGAGAAAGAGAAGG + Intergenic
1139601277 16:67988961-67988983 GAAGGAGGACGAGGAAGAAAAGG + Intronic
1139961627 16:70721366-70721388 GGAAGAGGAGGAGAAAGAAGAGG + Intronic
1140114846 16:72033000-72033022 GAAAAAGGATCAGTAACAAATGG + Intergenic
1140159249 16:72469118-72469140 GAGAAAGAATGAGATAGAAAGGG - Intergenic
1140217567 16:73020775-73020797 TGAATAGGATAAGACAGAAAAGG - Intronic
1140228778 16:73100172-73100194 GAAAAGGAATGAAAAAGAAATGG - Intergenic
1140255774 16:73334794-73334816 AAAAAAGAATGAGAAAGAAAAGG - Intergenic
1140326557 16:74009655-74009677 GAAAAAGGAGGAGGAAGAGAAGG + Intergenic
1140598985 16:76451770-76451792 AAAATATGATTAGAAAGAAGAGG + Intronic
1140870602 16:79102954-79102976 AAAGGAGGATGAGGAAGAAAAGG - Intronic
1140942522 16:79735225-79735247 AAAAGTGGAGGAGAAAGAAATGG - Intergenic
1140963224 16:79937781-79937803 GAAGGAGGAGGAGAAAGAGAAGG - Intergenic
1141376705 16:83537512-83537534 GAGATAGGAAGAAAAGGAAAAGG + Intronic
1141431536 16:83972721-83972743 TAAAGAGGCTGAGAGAGAAAGGG - Intronic
1142277649 16:89131099-89131121 GAAAAAGAAAAAGAAAGAAAGGG - Intronic
1142317588 16:89357880-89357902 AAAATAGGAAAAGAAAGGAAAGG - Intronic
1142547935 17:718480-718502 GAAAAAGAAAAAGAAAGAAAAGG - Intronic
1142784765 17:2212324-2212346 GACATACGAGGAAAAAGAAAGGG + Intronic
1142997930 17:3772140-3772162 GAATTAGCATGAGAAGGAACGGG - Intronic
1143534038 17:7525032-7525054 GAAAAAGAAAAAGAAAGAAAGGG + Intergenic
1144049405 17:11485702-11485724 CAAACAGGAAGAGAGAGAAAAGG + Intronic
1144126800 17:12210465-12210487 GAAGAAGGAAGAGGAAGAAAAGG - Intergenic
1144163402 17:12583430-12583452 TAAATAGAGTAAGAAAGAAAGGG - Intergenic
1144202795 17:12956364-12956386 GAAAGAGGATGAGAATCACAGGG + Intronic
1144544175 17:16177152-16177174 GATATAAAATTAGAAAGAAAAGG - Intronic
1144637082 17:16916999-16917021 GAAAAAGGAAAGGAAAGAAAAGG - Intergenic
1145099209 17:20059587-20059609 GAAGGAGGACCAGAAAGAAAAGG - Intronic
1145271937 17:21409463-21409485 GAAATGAGGTGAGAAAGAGAAGG + Intronic
1145310146 17:21696928-21696950 GAAATGAGGTGAGAAAGAGAAGG + Intronic
1145367378 17:22276007-22276029 GAAAAAGGAAGAGAAAAGAAAGG - Intergenic
1145798108 17:27667516-27667538 GGAAGAAGAGGAGAAAGAAAAGG + Intergenic
1146728582 17:35175097-35175119 GAAAAAAGAAAAGAAAGAAAGGG + Intronic
1146918944 17:36697008-36697030 GAAAGAAAAGGAGAAAGAAATGG + Intergenic
1147189260 17:38729518-38729540 GAAACAGGTTGGGATAGAAAGGG - Exonic
1147241953 17:39096279-39096301 GAAAAAGGCAGAGAAAGAAGAGG + Intronic
1147261707 17:39212854-39212876 GAAAGCGGGTTAGAAAGAAAGGG - Intronic
1147503523 17:40990107-40990129 AAAATAAGATGAGAAATAAAAGG - Intergenic
1147783089 17:42957909-42957931 GGAAGAGGAGGAGGAAGAAAAGG + Intronic
1148250352 17:46073289-46073311 AAAGTAGGATGAGCAAGGAAAGG + Intronic
1148580069 17:48737544-48737566 GAGAGAGGAAGAGAGAGAAAGGG + Intergenic
1148643258 17:49204076-49204098 GCATTAGGAAGAGACAGAAAAGG + Intronic
1148735193 17:49861204-49861226 GACAGGGGATGAAAAAGAAAAGG - Intergenic
1148812026 17:50299303-50299325 AAAAAAAGAAGAGAAAGAAAAGG - Intergenic
1149011155 17:51857905-51857927 GAAATTGGATGAGAAATTCAGGG + Intronic
1149132736 17:53325648-53325670 GAAATAGGAGGAGAAAGATAAGG - Intergenic
1149167742 17:53773824-53773846 GAAAAAGGAAGAGAAACAGAAGG - Intergenic
1149179179 17:53913799-53913821 GAAAAAAGAAAAGAAAGAAAAGG - Intergenic
1149379545 17:56079531-56079553 GAAATAGAGTCAGAAAGAAGAGG + Intergenic
1149696996 17:58623837-58623859 GGAGGAGGAGGAGAAAGAAAAGG + Intronic
1150155644 17:62850812-62850834 GAAAAAGAAAGAGAAAGAAAAGG - Intergenic
1150570324 17:66380506-66380528 GAAATAGCAGGATAAATAAATGG - Intronic
1151033217 17:70766465-70766487 TAGATGGGATGAGAGAGAAAGGG + Intergenic
1151085591 17:71376881-71376903 AAAATAGGATGAGAAAGGAGTGG + Intergenic
1151383911 17:73743733-73743755 GAAAGAGGAAGAGAAAGAAGAGG - Intergenic
1151429835 17:74055024-74055046 GAAAGAGGGAGAGAGAGAAAGGG - Intergenic
1151429894 17:74055399-74055421 GAGAGAGGAAGAGAAAGAGAGGG - Intergenic
1151526390 17:74671785-74671807 GAAACAGGATCAGACAGAAAGGG - Intronic
1151606888 17:75143201-75143223 GAAATACGATTAGACAAAAAAGG - Intronic
1152021401 17:77781764-77781786 GAGAGAGGAGGGGAAAGAAAGGG - Intergenic
1152261744 17:79270950-79270972 GAAAGAGAAAGAAAAAGAAAAGG - Intronic
1153295411 18:3541272-3541294 GAAAGAAGAAGGGAAAGAAAAGG + Intronic
1153550731 18:6258965-6258987 GAAATAGGGTAAGAAAGGAGTGG + Intronic
1153583003 18:6594239-6594261 GAATGAGGAAGAGAAAGAAGGGG + Intergenic
1153597850 18:6746805-6746827 GAAAGAGAAAGAGAGAGAAACGG + Intronic
1153671289 18:7414983-7415005 GAAAGAGAATAACAAAGAAAAGG + Intergenic
1153783990 18:8518001-8518023 CAAATAAGATGAAATAGAAATGG + Intergenic
1154031261 18:10756140-10756162 GATGGAGGATGAGAAAGAAATGG + Intronic
1154396800 18:13998226-13998248 GGAATTCGATGAGAAAGGAAAGG - Intergenic
1155485786 18:26340739-26340761 GATCTAGGATGAGAAAGAAGGGG + Intronic
1155527052 18:26727857-26727879 GAAATAGGAGGAGGAAGAAGAGG - Intergenic
1155829013 18:30488208-30488230 CAAATAGGAAAAAAAAGAAAGGG - Intergenic
1156211178 18:34944730-34944752 GAAGGAGGAGGAGAATGAAAAGG + Intergenic
1156243509 18:35275852-35275874 GAACCAGTATGAGAAAAAAATGG - Intronic
1156421552 18:36959589-36959611 GGAACAGGAGGAGAAAGGAAAGG - Intronic
1156585641 18:38428060-38428082 GAAATAGGAAGAGAGGGAAAAGG + Intergenic
1156918176 18:42486017-42486039 GAAAGAGGAAGAGAAGGAGAGGG - Intergenic
1157002912 18:43549015-43549037 AATATAGCAAGAGAAAGAAAAGG + Intergenic
1157169463 18:45388835-45388857 GTGATAGGATGATAAAGCAAAGG + Intronic
1157366909 18:47073583-47073605 GGAATAGAAAGAGAAACAAATGG - Intronic
1157424201 18:47570966-47570988 GAAATGGAATGAGAGTGAAATGG - Intergenic
1157958639 18:52127213-52127235 GAAATAGGTAGAGAAAGAAAAGG - Intergenic
1158298038 18:56020894-56020916 GAAATAGGAGTAGAATCAAATGG - Intergenic
1158341578 18:56472332-56472354 GAAGTAGGAGGAGAAAGATAAGG - Intergenic
1158633411 18:59135472-59135494 AAAATAGGATGTGAAGGACAGGG - Intergenic
1158732698 18:60041917-60041939 TAAATAGGATTTAAAAGAAAAGG + Intergenic
1159146845 18:64465633-64465655 AAAATTGGAAGAGAAAGATAAGG + Intergenic
1159185741 18:64971208-64971230 AAAATACCATGAGAAAGAAAAGG - Intergenic
1159191355 18:65047347-65047369 GAGACAGAAAGAGAAAGAAAAGG + Intergenic
1159409746 18:68055822-68055844 AAAAGAGAATGAAAAAGAAATGG + Intergenic
1159517673 18:69478399-69478421 GAAAAAGGAGGAGAAGGAAGGGG - Intronic
1159554261 18:69928815-69928837 GAAAGAGTAAGGGAAAGAAAAGG + Intronic
1159860736 18:73646373-73646395 GAAATAGCAGGAGGAAGCAATGG - Intergenic
1160057651 18:75499512-75499534 GAAAGAGGAGGAGGAAGAGAGGG + Intergenic
1160231989 18:77055567-77055589 GAGAAAGAAAGAGAAAGAAAAGG - Intronic
1160951182 19:1668413-1668435 GAGATAGGAACAGAAAGAGAAGG - Intergenic
1161256087 19:3310615-3310637 GAAAGAGAATGAGAGAGAGATGG - Intergenic
1161845187 19:6708064-6708086 GAAAGAGAAAGAGAAAGGAAGGG - Intronic
1161902610 19:7130834-7130856 GAAAAAGAAAAAGAAAGAAAAGG - Intronic
1162783057 19:13017165-13017187 GAGAGAGGGTGAGAAAGAAAGGG + Intronic
1163211689 19:15845530-15845552 GAAAGAGAAGGAGAAAGAGAAGG + Intergenic
1163801125 19:19366327-19366349 GAAATTGGCTGGGAAAGGAAAGG + Intergenic
1164203042 19:23034118-23034140 GAAAAAGGCTTAGAAATAAAAGG + Intergenic
1164249823 19:23466861-23466883 GAAGGAGCAGGAGAAAGAAAAGG - Intergenic
1164612453 19:29641836-29641858 GAAAGAGGAGGAGAAGGAGAAGG + Intergenic
1164634966 19:29785447-29785469 GAAAGGGGAGGAGAAAGAAAAGG + Intergenic
1164771975 19:30816366-30816388 GGAAAAGGAAGAGAAAGAGAGGG - Intergenic
1164772293 19:30818983-30819005 GAGATAGGAAGAGCAAGACAAGG - Intergenic
1164787426 19:30944687-30944709 GAAAGAGAAAGAGAAAGGAAAGG + Intergenic
1164936623 19:32219929-32219951 AAGAGAGGATAAGAAAGAAAAGG - Intergenic
1165004242 19:32791542-32791564 CAAATAGCATGAGAGAGAAGTGG + Intronic
1165018347 19:32901381-32901403 GAAGGAAGAAGAGAAAGAAAGGG - Exonic
1165198330 19:34124428-34124450 AAAATGTGATGAGACAGAAAAGG + Intergenic
1165559253 19:36665116-36665138 GAATTAAGAGGAAAAAGAAAAGG + Intronic
1165573249 19:36792816-36792838 GAAAAAGAAAGAAAAAGAAAAGG - Intergenic
1165788743 19:38478118-38478140 GAAACAGGATGAGAAGGAAAAGG - Intronic
1166061755 19:40330162-40330184 GAAACAGGCAAAGAAAGAAAGGG - Intronic
1166686494 19:44799692-44799714 GAAAGAGAGAGAGAAAGAAAGGG + Intronic
1166686500 19:44799751-44799773 GAAATAGAAAAAGAAAGAAAGGG + Intronic
1167126183 19:47550370-47550392 GAAAGAGAAAGAGAAAGATAAGG + Intronic
1167169218 19:47820043-47820065 GAGGGAGGAGGAGAAAGAAAGGG + Intronic
1167369948 19:49074560-49074582 GAAAAAGAAAAAGAAAGAAAAGG - Intergenic
1167390955 19:49194631-49194653 GAAAGAGAGAGAGAAAGAAAGGG - Intronic
1167429115 19:49444088-49444110 GAAAAAAGAAGAGAAAGAAGAGG - Intergenic
1167660086 19:50791252-50791274 GACATAGGAGGAGACAGAAAAGG - Intronic
1167789728 19:51666723-51666745 GAAAAAGAAAGAGAAAGGAAAGG + Intergenic
1168284945 19:55326519-55326541 GAAAAAGGAGGAGAAAGACCAGG + Intronic
925166446 2:1718821-1718843 CAAACAGGCTGAGGAAGAAATGG + Intronic
925615430 2:5740705-5740727 GAAGGAGGATAATAAAGAAAAGG - Intergenic
925659152 2:6184113-6184135 GAGAGAGGGGGAGAAAGAAAAGG + Intergenic
925659222 2:6184489-6184511 GAGGAAGGAAGAGAAAGAAAAGG + Intergenic
925685314 2:6465714-6465736 GAAATAGGAGGAAATTGAAAGGG - Intergenic
925878885 2:8334005-8334027 AAAAAGGAATGAGAAAGAAAAGG + Intergenic
926058645 2:9791680-9791702 CAAATAGGATGAGAAGTCAAAGG + Intergenic
926339879 2:11896144-11896166 GAAGGAGGATGGGAAAGATATGG + Intergenic
926722655 2:15972894-15972916 GAAAGAGTATGGGAAAGTAAAGG + Intergenic
927267974 2:21174337-21174359 AAAAAAGGAAGAGAAAGAAAAGG - Intergenic
927369036 2:22333240-22333262 GAAAAAGGAGGAGGAGGAAAGGG - Intergenic
927373289 2:22382823-22382845 AAAATGAGTTGAGAAAGAAAAGG + Intergenic
927526940 2:23752677-23752699 GAAATATAATGAGGAAGGAAGGG - Intronic
928068775 2:28193786-28193808 GGAATAAAATGAGAAAGCAAAGG - Intronic
928216832 2:29368739-29368761 GAAAAAGGAGGAGGAAGACAGGG - Intronic
928254581 2:29711130-29711152 GGCATAGGATGGAAAAGAAAGGG - Intronic
928347906 2:30517725-30517747 GAAAGAGGTAGAGAAACAAAGGG + Intronic
928504958 2:31941374-31941396 TATATAGGATTAGTAAGAAAAGG - Intronic
928604073 2:32927879-32927901 GAAGAAAGATGGGAAAGAAAAGG + Intergenic
928704120 2:33929274-33929296 GAAATATGCTGATAAACAAATGG + Intergenic
928813229 2:35254726-35254748 TAAATAGGCTTAGAAAAAAATGG + Intergenic
928889579 2:36187731-36187753 CAACTAGGATGAGACAGAAAAGG + Intergenic
929158164 2:38806817-38806839 GAAACAAAATAAGAAAGAAAGGG - Intronic
929518192 2:42623555-42623577 GAAAAAGAAAGAGAAGGAAAAGG - Intronic
929713895 2:44291872-44291894 CAAAGAGGAGGAGAAAGAGAAGG - Intronic
929894051 2:45943025-45943047 GAAATATTATGTGAAATAAATGG - Intronic
929990932 2:46785918-46785940 TAAATGTAATGAGAAAGAAATGG + Intergenic
930341910 2:50127517-50127539 GAAAGAGGATGAGAAAGTATTGG - Intronic
930462847 2:51705642-51705664 AAAATAGGATGAGAAATTTAGGG - Intergenic
930495164 2:52132197-52132219 GTAAAAGGATGAGAAAAATAAGG - Intergenic
930543221 2:52734023-52734045 GAACTAGTAAGAGGAAGAAATGG - Intergenic
930576961 2:53162689-53162711 GAAATATTAAGAGAAAGGAAAGG + Intergenic
930587808 2:53290217-53290239 GAAGTAGGAGGAGAAAGAAGGGG - Intergenic
930698661 2:54437437-54437459 GAAATAACATGAGATAGAAATGG - Intergenic
930774630 2:55159868-55159890 AAAAAAAGATAAGAAAGAAAGGG - Intergenic
930937998 2:56980318-56980340 TAATTAGGAGGAGAAAGAAAAGG - Intergenic
931385671 2:61795568-61795590 GAAAGAGGAAGGGAAAGAAAAGG + Intergenic
931950399 2:67355852-67355874 AAAGAGGGATGAGAAAGAAAGGG + Intergenic
932441056 2:71735729-71735751 GAAATAGAATGAGATCGAAATGG + Intergenic
932459092 2:71870990-71871012 GCAATTGGATAAGAAAGAAACGG + Intergenic
932474306 2:71991976-71991998 GAGGAAGGATGAAAAAGAAAGGG - Intergenic
932524885 2:72454627-72454649 AAAATAGGATTAGAAGTAAATGG + Intronic
932734408 2:74244513-74244535 AAAAAAGAAAGAGAAAGAAAGGG - Intronic
932970492 2:76535050-76535072 GAAATAGGATTAGATTAAAATGG + Intergenic
933070505 2:77851896-77851918 GAAAGAGAATGAGAAGGAGAGGG + Intergenic
933084496 2:78038752-78038774 GAAGTAGGAGGAGGAAGAAAAGG - Intergenic
933124611 2:78588711-78588733 GAATTAGAATGAGAAAGAATGGG + Intergenic
933304707 2:80582770-80582792 GCAAGAGGTTGAGAAAGAGAAGG + Intronic
933482674 2:82876536-82876558 GAAAAAGAAAAAGAAAGAAAAGG + Intergenic
933483858 2:82893672-82893694 AAAGGAGGATGAAAAAGAAATGG - Intergenic
933656308 2:84889830-84889852 GGAGTAAGAGGAGAAAGAAAAGG + Intronic
933697708 2:85232335-85232357 GAAATATGATTAAAAAGAAATGG - Intronic
933769588 2:85734556-85734578 GAGAGAGGAGGAGAAAGAAAAGG + Intergenic
933843001 2:86302846-86302868 TCAATAGGATGGGGAAGAAAAGG - Intronic
933997782 2:87682542-87682564 GAAAGAGAAAGAGAAAGAAAAGG + Intergenic
934149980 2:89136888-89136910 AAAAAAGGAAGAGAAAGAGAGGG + Intergenic
934217315 2:90045140-90045162 AAAAAAGGAAGAGAAAGAGAGGG - Intergenic
934868541 2:97837880-97837902 GAAATAGGAAGGGACAGAGAAGG - Intronic
935279990 2:101508647-101508669 GAGAGAGAATCAGAAAGAAAAGG + Intergenic
935313199 2:101805880-101805902 GAAACAGGGTGAGAAGGAAGCGG - Intronic
935561174 2:104561638-104561660 GAAAAAAGATGAGAATGAAAGGG - Intergenic
935645088 2:105328407-105328429 GAAATGGAAGGAAAAAGAAAAGG + Intronic
935728618 2:106046149-106046171 GAAATAGGATGAAGATGAAGAGG - Intergenic
935738286 2:106124272-106124294 GACAAAGGACAAGAAAGAAAAGG + Intronic
935796748 2:106649284-106649306 GAGAAAGGACGAGAAATAAAAGG + Intergenic
935892821 2:107698132-107698154 GAAATAGTATTAAAAAAAAAAGG - Intergenic
935940629 2:108234731-108234753 GAACTAAAAAGAGAAAGAAAAGG + Intergenic
936181922 2:110274523-110274545 GAAATAGAAATAGAAATAAAGGG - Intergenic
936230646 2:110697156-110697178 GAAATAGAAATAGAAATAAAGGG + Intergenic
936296072 2:111268328-111268350 GAAAGAGAAAGAGAAAGAAAAGG - Intergenic
936514187 2:113171482-113171504 GAAAGAGGCTGAGAAAGCTAGGG + Intronic
936755464 2:115704490-115704512 AAAAAAGGAGGAGGAAGAAATGG - Intronic
936820373 2:116512391-116512413 AAAATAGGAGGAGAAAAACATGG - Intergenic
936832829 2:116669829-116669851 GAAGAAGGAAGAGAAAGAGAAGG - Intergenic
937089323 2:119195657-119195679 GAAAGAGAGAGAGAAAGAAAAGG + Intergenic
937388199 2:121456539-121456561 AAAAAAGGAAGAAAAAGAAAAGG + Intronic
937508262 2:122561595-122561617 AAAAATGGATGTGAAAGAAAGGG + Intergenic
937538850 2:122924422-122924444 GGATAAGGATGGGAAAGAAAAGG - Intergenic
937550892 2:123089418-123089440 ATAATAGGCTGAGAAATAAATGG - Intergenic
937852116 2:126644932-126644954 GAAGGAGGAAGAGAGAGAAAGGG - Intergenic
937998839 2:127715918-127715940 AAAGGAGGAAGAGAAAGAAAGGG + Intronic
938026569 2:127954277-127954299 CAAACAGCATGAGAAAGAAATGG + Intronic
938164082 2:129011015-129011037 GAGAGAGGATGAGAAAGAAAAGG + Intergenic
938164096 2:129011105-129011127 GAGAGAGGATGAGAGAGAAAAGG + Intergenic
938451734 2:131426714-131426736 GGAAGAGGAGGAGAAAGAAGAGG + Intergenic
939216086 2:139240089-139240111 GATATAGGATGCCACAGAAAAGG + Intergenic
939233552 2:139462687-139462709 GAAAAAGGAAAATAAAGAAATGG - Intergenic
939300071 2:140325169-140325191 GAAAAAGTATGAGGAAGAGAAGG + Intronic
939413860 2:141866844-141866866 GAAATAGAAGGAGAGAAAAAAGG + Intronic
939433032 2:142135177-142135199 GACACAAGATGAAAAAGAAAGGG + Intergenic
939458391 2:142467119-142467141 GAAATAGCATTAGAAAGAAATGG - Intergenic
939865425 2:147467160-147467182 GAAATAAAAAAAGAAAGAAAAGG + Intergenic
939981325 2:148785246-148785268 GAGAAAGGAAAAGAAAGAAAAGG + Intronic
940041166 2:149362427-149362449 GAAATATGATGGGATAAAAAGGG + Intronic
940315555 2:152324482-152324504 AAAAAAGGAAAAGAAAGAAAGGG - Intergenic
940317413 2:152339717-152339739 GAAAAAAAATGAGAAGGAAATGG - Intronic
940515736 2:154682141-154682163 GAAATAGGATTAGAGAAAAAAGG + Intergenic
940837911 2:158545337-158545359 AAATAAGGACGAGAAAGAAAGGG + Intronic
941142249 2:161799522-161799544 GAAACAGGAAGAAAATGAAATGG + Intronic
941147836 2:161874574-161874596 CAAATGTGAAGAGAAAGAAAAGG - Intronic
941235239 2:162963655-162963677 GCAGTAGGAACAGAAAGAAAGGG - Intergenic
941700485 2:168599256-168599278 GAAATAGGATGTGAGAGGATTGG - Intronic
941900475 2:170673210-170673232 GCAGCAGGATGAGGAAGAAAGGG - Intergenic
941950337 2:171149293-171149315 GAAATTGAATGAGAAATACATGG - Intronic
942234101 2:173887906-173887928 GAAAGAGGAGCAGAGAGAAAAGG + Intergenic
942261167 2:174165340-174165362 GACATAAGAGGTGAAAGAAAGGG + Intronic
942348077 2:175024065-175024087 AAAAAAGGATGGGAAAGATATGG - Intergenic
942682342 2:178490639-178490661 GAACTATGATGATAAACAAAGGG - Exonic
942883848 2:180897601-180897623 GAAATGGTATGAGAAACTAAGGG - Intergenic
942964243 2:181871100-181871122 GAAGTTAGATAAGAAAGAAAGGG - Intergenic
942985403 2:182134745-182134767 GAAGGAGGAGGAGAAAGGAAAGG + Intergenic
943024464 2:182610192-182610214 GAAATAGGATTGGACAAAAAGGG - Intergenic
943557188 2:189420031-189420053 GAAAGAGAATAAGAAAGAGAGGG + Intergenic
943692555 2:190882524-190882546 GAAATAGCAGCAGAAATAAAAGG - Intronic
943816036 2:192256490-192256512 GAAATAGAATGACAAAAATATGG - Intergenic
943885187 2:193207787-193207809 CAGATAGGGTGAGAAATAAAAGG + Intergenic
944003291 2:194868707-194868729 AAAAAAGCAGGAGAAAGAAAAGG - Intergenic
944058009 2:195543771-195543793 GAATTATGATGAGGAATAAATGG - Intergenic
944131213 2:196349341-196349363 GAAATATAATTACAAAGAAAGGG + Intronic
944272463 2:197798551-197798573 GAATTAAGATGAGAAATAAGAGG + Intergenic
944699855 2:202237490-202237512 AGAACAGGATGAGGAAGAAAAGG + Intronic
944711469 2:202338673-202338695 GAAAGAGGGAAAGAAAGAAAGGG - Intergenic
944928340 2:204489449-204489471 CAAAGAGGTGGAGAAAGAAATGG - Intergenic
945118613 2:206435436-206435458 GAAGAAGGCAGAGAAAGAAAAGG - Intergenic
945370940 2:209016938-209016960 GAAAGAGGATGAGAAACAAGTGG - Intergenic
945374006 2:209057784-209057806 GAAAAACTATAAGAAAGAAATGG - Intergenic
945456162 2:210054769-210054791 GAAAAAGGAGGGGAAAGGAAGGG + Intronic
945772944 2:214067817-214067839 GAAATACGGTGAGAAAGTAGGGG - Intronic
945778889 2:214142495-214142517 GAAAGAGGAAAAGAAATAAAGGG - Intronic
945831114 2:214786470-214786492 GAAATATGAGGTGAAAGAATAGG - Intronic
945903526 2:215565586-215565608 GAAATAGTGAGAAAAAGAAAAGG + Intergenic
945916839 2:215713327-215713349 GAGAGAGGCAGAGAAAGAAAAGG + Intergenic
945949042 2:216021426-216021448 GGACTAGGATGAGAAGGGAAGGG + Intronic
945966267 2:216190589-216190611 TAAATAGGAACAGAAAGCAAAGG - Intronic
946126376 2:217566629-217566651 GAAAAAGGAGGAGGAAGAGATGG + Intronic
946303295 2:218839217-218839239 GAAAGAGGAAGAGGAGGAAAAGG - Intergenic
946358325 2:219203162-219203184 GAAACAGGAAAAAAAAGAAATGG - Intronic
946531971 2:220580118-220580140 AAAGGAGGAGGAGAAAGAAAAGG - Intergenic
946969392 2:225074933-225074955 GAAAAAAGAAAAGAAAGAAAAGG + Intergenic
947118076 2:226792093-226792115 GAAACTGAATGAAAAAGAAATGG + Intronic
947199179 2:227599333-227599355 GAAAAAGGATTAGACAGAATGGG - Intergenic
947227060 2:227850823-227850845 GAAACAGGAATAGAAAGAATTGG - Intergenic
947327049 2:228991109-228991131 GAAGTAGGAGGAGACAGAAGAGG - Intronic
947433582 2:230052922-230052944 GAAAGAGAGAGAGAAAGAAAGGG - Intronic
947447686 2:230176976-230176998 GAAATGGAAGGAGAAAGGAATGG - Intronic
947924042 2:233905454-233905476 GACATAGGATATGAAAGAAAAGG - Intergenic
947946263 2:234105629-234105651 GAAAAAGGATAAGAAGAAAAAGG + Intergenic
948123516 2:235548308-235548330 GAAAGTGGAGGAGAAGGAAATGG - Intronic
948559362 2:238841052-238841074 TAAATAGAATCAGAAAGAATAGG - Intergenic
948666937 2:239541405-239541427 AAAATATTATGAGAAATAAAAGG - Intergenic
948966090 2:241381465-241381487 AAATGAGGGTGAGAAAGAAATGG - Intronic
1169342684 20:4808447-4808469 GAAAGGGGACAAGAAAGAAAGGG + Intronic
1169356895 20:4914265-4914287 GAAAAAGGATGGAAAGGAAATGG + Intronic
1169669082 20:8075278-8075300 GAAGGAGGATGAGAAATATATGG - Intergenic
1169974710 20:11311608-11311630 GAAATTGGGTGAGTACGAAAAGG - Intergenic
1170220212 20:13934100-13934122 GGAAGAGGATGAGGAATAAAAGG - Intronic
1170878433 20:20272790-20272812 GAAATGGAGAGAGAAAGAAAGGG - Intronic
1170988286 20:21278482-21278504 AAGAAAGGAAGAGAAAGAAAAGG + Intergenic
1171077468 20:22143120-22143142 GGAAGAGGAGGAGAAAGAAGAGG - Intergenic
1171333345 20:24360705-24360727 GAAAAAGGAAGGGAAAGGAAAGG + Intergenic
1171545339 20:25996601-25996623 GAAAAAGAAAGAAAAAGAAAAGG + Intergenic
1172522880 20:35579602-35579624 GAAACAGGATGAGAAGGCAATGG - Intergenic
1172798608 20:37560573-37560595 ACAATAGGATGAAAGAGAAAGGG - Intergenic
1173001274 20:39107482-39107504 GAAATAATGTGAGAAAGAGAAGG + Intergenic
1173036448 20:39415844-39415866 AAAATAGGAAGAGAAAAAACAGG + Intergenic
1173419267 20:42886439-42886461 GAAATACCATGAGGAATAAATGG + Intronic
1173591092 20:44225395-44225417 GAGATAGGAAAAGAAAAAAAAGG - Intergenic
1173777491 20:45722795-45722817 GTATTGGGATGAGAGAGAAAGGG + Intronic
1173802917 20:45906042-45906064 GAAACAGGATGAGATATAAAAGG + Intronic
1174040062 20:47693304-47693326 GAAATGGCATGAGAATGAGATGG + Intronic
1174691229 20:52508067-52508089 GAAAGAGGATAACAAAAAAATGG + Intergenic
1174732243 20:52929251-52929273 AGAATGGGATGGGAAAGAAATGG - Intergenic
1174880857 20:54277653-54277675 GAAAGAGAGAGAGAAAGAAAGGG - Intergenic
1174887216 20:54348974-54348996 GGAATAAGATGGGAAAGAATAGG + Intergenic
1174922739 20:54722206-54722228 GAAATAGGATCTGCATGAAAAGG + Intergenic
1175023975 20:55881842-55881864 AAATGAGGATGATAAAGAAAAGG + Intergenic
1175134334 20:56811519-56811541 AAAAGAGGTTAAGAAAGAAAGGG + Intergenic
1175474994 20:59265883-59265905 GAATTAGGATGAAAAAGAAATGG + Intergenic
1176193267 20:63824209-63824231 GAAATGGGAGGAGGAAGAAATGG + Intronic
1176699737 21:10030636-10030658 GAATTTGAATCAGAAAGAAAAGG - Intergenic
1176902638 21:14461767-14461789 GAACTTGAAAGAGAAAGAAAAGG - Intergenic
1177279933 21:18967998-18968020 TAAATAGAATGAGAAAAAATTGG + Intergenic
1177408752 21:20702715-20702737 GATATGAGATGAGAAAGAAAGGG - Intergenic
1177537608 21:22448703-22448725 GACATAGGAGGACATAGAAAGGG + Intergenic
1177660871 21:24082285-24082307 AAAGTAAGAAGAGAAAGAAAAGG - Intergenic
1177680264 21:24359024-24359046 GAAAGAGGATGAGAAGCATATGG + Intergenic
1178092170 21:29176007-29176029 GAAAGAGAAAAAGAAAGAAAGGG - Intergenic
1178120495 21:29465171-29465193 GGAAGAAGGTGAGAAAGAAATGG + Intronic
1178150999 21:29793517-29793539 GAAGGAGGAGGAGAAGGAAAAGG - Intronic
1178433510 21:32537019-32537041 GAAAGAGAAGGAGGAAGAAAAGG + Intergenic
1178725122 21:35044569-35044591 GAAAAAAGAAAAGAAAGAAAAGG + Intronic
1178920794 21:36736883-36736905 GAAAAAGAAAGAAAAAGAAAAGG - Intronic
1179185380 21:39081701-39081723 GAAGGAGGATGAGAAGGAGAAGG + Intergenic
1179425479 21:41274968-41274990 GAAAAAAGAGGAGAAAGAGAAGG - Intronic
1179510896 21:41872831-41872853 GAAATAAGATGAGAAAGAAAGGG + Intronic
1179525407 21:41972936-41972958 GAACTGGGATGAGAAAGAGTAGG - Intergenic
1180190963 21:46162200-46162222 CAAATAGAATCTGAAAGAAAAGG + Intronic
1181161428 22:20962199-20962221 AAAAGAGAAAGAGAAAGAAAAGG - Intergenic
1181587478 22:23861487-23861509 CACTTAGGATGAGAAAGGAAGGG + Intronic
1181691072 22:24561037-24561059 GAAAAAGGAAAAGAAAAAAAAGG - Intronic
1182007473 22:26972999-26973021 AAAAGAGGTTGAGAAATAAAGGG + Intergenic
1182185828 22:28401164-28401186 GGAAGAGGAGGAGAAGGAAAAGG + Intronic
1182202347 22:28586602-28586624 GTAAGAGGATGAAAAGGAAAAGG + Intronic
1182205838 22:28625222-28625244 GAAAAAGAAAAAGAAAGAAAAGG + Intronic
1182222519 22:28770381-28770403 GAAAGGGCAAGAGAAAGAAAAGG - Intergenic
1182231204 22:28838746-28838768 AAAATAAAATAAGAAAGAAATGG + Intergenic
1182466775 22:30521752-30521774 GAAAGAGAAAGAAAAAGAAAAGG - Intergenic
1182677771 22:32053271-32053293 GTAATAGGAAGAGAAGAAAAGGG - Intronic
1183002431 22:34872577-34872599 GAAGGAGGAAGAGAAAGAGATGG - Intergenic
1183539649 22:38422766-38422788 GAAGGAGGAAGAGGAAGAAAGGG - Intergenic
1183848531 22:40563207-40563229 GAAGTAGGATGGGGAAGAAGAGG - Intronic
1184181444 22:42830110-42830132 AAAATAAGAAGAAAAAGAAAAGG - Intronic
1184318046 22:43713847-43713869 CAAACAGGATGAAAAATAAATGG + Intronic
1184366341 22:44054006-44054028 GAAATAGGATTGGACAGCAAGGG + Intronic
1184714160 22:46271221-46271243 GAAAAAAGAAAAGAAAGAAAAGG - Intronic
1184789508 22:46690860-46690882 TAAATAGGAAGAGAAACAACGGG + Intronic
1185084695 22:48734182-48734204 GAAAGAACATGAGTAAGAAATGG + Intronic
949110308 3:252795-252817 GAAATATTATAAGAAACAAATGG - Intronic
949215156 3:1558554-1558576 GAGATATGAAGAGATAGAAAGGG + Intergenic
949499057 3:4661507-4661529 GAAGTAGGGAGAGAAAGTAAAGG - Intronic
949828805 3:8191762-8191784 GAAGGAGGAGGAGAAAGAAGAGG - Intergenic
949954289 3:9254977-9254999 GAAAAAGAAAAAGAAAGAAAGGG + Intronic
950684477 3:14606647-14606669 GAAATAGGAGGAGAAATCACAGG + Intergenic
951014179 3:17711745-17711767 GAGATAGGATGAAAAAGTTATGG - Intronic
951158844 3:19390447-19390469 AAAAAAGGTTGAGAAATAAAAGG - Intronic
951280489 3:20743152-20743174 GTAACAGGGTGTGAAAGAAAGGG - Intergenic
951402731 3:22253953-22253975 GGAAAAGGATTAGAAAGAATTGG - Intronic
951594659 3:24304961-24304983 GTAATAAGAAGAGACAGAAATGG + Intronic
951902235 3:27668161-27668183 GGAACAGGAAGAGAAAGGAAGGG + Intergenic
951918108 3:27823021-27823043 CTAATAGCATGAGAATGAAAAGG - Intergenic
951968001 3:28409808-28409830 GAAATAGCATAATAAATAAAAGG + Intronic
952047333 3:29338726-29338748 GAATAAGGATGAGGAAGGAAGGG - Intronic
952093040 3:29914262-29914284 GAATTAGGATGTGTAAGAGAAGG + Intronic
952465939 3:33586124-33586146 GAAAAAAGAAAAGAAAGAAAAGG - Intronic
952788763 3:37181320-37181342 GGAACAGGGTGAGAATGAAAGGG + Intronic
953203644 3:40800479-40800501 GTGAGAGGAGGAGAAAGAAAGGG - Intergenic
953248189 3:41216032-41216054 GAAATATGATTAGATTGAAAGGG + Intronic
953721951 3:45363887-45363909 GAAAGAGCAAGAGAAGGAAATGG - Intergenic
954050810 3:47975495-47975517 GAAGTAGGAAGGGGAAGAAAAGG + Intronic
954286190 3:49621058-49621080 GACTTAGGATGAGACAGGAAGGG + Intronic
955002907 3:54943745-54943767 GAAATAGGATGACACAGAGAGGG - Intronic
955027233 3:55180537-55180559 GGAACAAGATGAGAAAGGAAAGG - Intergenic
955307469 3:57848637-57848659 GAAGGAGGAGGAGGAAGAAAAGG - Intronic
955372353 3:58363732-58363754 AAAATAGGAAAAGAAATAAACGG - Intronic
955446380 3:59015464-59015486 GGAAAAGGATGAGGGAGAAAAGG + Intronic
955545432 3:60023650-60023672 GAAATAGGAAATGAGAGAAAGGG + Intronic
955647200 3:61152614-61152636 GAGATGAGATGAGAAAGCAAGGG + Intronic
955672100 3:61412658-61412680 GAAATAAGAAAAGAAAGGAAAGG + Intergenic
955829424 3:62985409-62985431 GATATAGGATGAGTAAGACCTGG - Intergenic
955901822 3:63764145-63764167 GAAATAAGAGGAGAAGGAGAAGG + Intergenic
955936797 3:64109940-64109962 TTAATAGGATGAGCAAGGAAAGG - Intronic
956037521 3:65110991-65111013 GAGACAGGAGGAGAGAGAAATGG + Intergenic
956152257 3:66256144-66256166 GAAAAAATAAGAGAAAGAAAAGG - Intronic
956191551 3:66612962-66612984 GAAAGAGAAAGAGAGAGAAAAGG - Intergenic
956201811 3:66714198-66714220 GATATAGGTTAAGAAAGAGATGG + Intergenic
956216427 3:66854117-66854139 GAAATAGGGTTAGACAGGAAAGG + Intergenic
956250745 3:67231404-67231426 GAAATAGGTTCAGACAGAAGGGG - Intergenic
956293271 3:67684258-67684280 GAAATAGGATGAACAACAACAGG - Intergenic
956300694 3:67769523-67769545 GAAAAAGGATCAGAAAAAAGAGG - Intergenic
956307664 3:67843814-67843836 GGAATAGGCTTAGAGAGAAAGGG - Intergenic
956370588 3:68555359-68555381 GTAATAGGATGATAATGGAAAGG + Intergenic
956373485 3:68589096-68589118 GACATAGAAGGAGTAAGAAATGG + Intergenic
956486121 3:69723652-69723674 TAAAAAGAAAGAGAAAGAAAGGG - Intergenic
956652354 3:71516334-71516356 GAAAAAGAATGAAAAACAAATGG + Intronic
956680427 3:71774454-71774476 GAAAGAGGAAGAGAAGCAAAAGG - Exonic
956812683 3:72879713-72879735 GAACCAGGCTGAAAAAGAAATGG - Intergenic
956846546 3:73188855-73188877 GAAAGAGGAGGAAAAAGAAGAGG - Intergenic
956923710 3:73958910-73958932 GATATGGGAAGATAAAGAAAAGG + Intergenic
957005519 3:74941742-74941764 GAAAGAGTAAGAGAAAGAAAAGG + Intergenic
957027162 3:75195019-75195041 GAAATGGAAAAAGAAAGAAAAGG - Intergenic
957029679 3:75225922-75225944 GAAAAAGAAAGGGAAAGAAAGGG - Intergenic
957316238 3:78580172-78580194 AAGATAGGAAGAGAAAGCAAGGG + Intergenic
957328499 3:78728201-78728223 GAAGGAGGAGGAGAAGGAAAAGG + Intronic
957564306 3:81865122-81865144 GTGATAGAATGAGACAGAAAGGG - Intergenic
957648399 3:82966010-82966032 GAATTAAAATAAGAAAGAAAAGG - Intergenic
957702281 3:83730606-83730628 GAAATATGAAAAGAAAAAAATGG - Intergenic
957795548 3:85001187-85001209 GAAAGGAGATGAGAGAGAAAGGG - Intronic
958060005 3:88467291-88467313 GGAAGAGGATGAGATGGAAAAGG - Intergenic
958105189 3:89063920-89063942 GAAATAGTATGAGGAAGACTGGG - Intergenic
958449461 3:94255977-94255999 GAGAAAGGAAAAGAAAGAAATGG + Intergenic
958535932 3:95402970-95402992 GAATTAAGTTGAGAAAGAAGAGG - Intergenic
958536772 3:95414228-95414250 GAAAGAGAAAGAGAAAGAAAAGG + Intergenic
958544728 3:95529996-95530018 AAAAAAGAATGAAAAAGAAAAGG - Intergenic
958564212 3:95787031-95787053 GAAAGAGGATCAGAGAGAGAGGG - Intergenic
958664682 3:97121342-97121364 GAAATATGTTGAGATAGAAGAGG + Intronic
958731633 3:97966285-97966307 AACATAGGAGGAGAAAGAGAGGG - Intronic
958766262 3:98372044-98372066 GAAAAAGAAAGAGAGAGAAAAGG + Intergenic
958816666 3:98924027-98924049 GAAGTTGGATGAGGAAGAGAAGG - Intergenic
959188443 3:103077921-103077943 GAAGTAGGAAGAGAGAGAAAAGG - Intergenic
959246943 3:103882572-103882594 GAAGAAGGAGGAGAAAGGAAAGG + Intergenic
960003515 3:112757870-112757892 GAAATTTAATGAGAAAAAAATGG - Intronic
960201272 3:114839473-114839495 GAGAAAGAAAGAGAAAGAAAGGG + Intronic
960204102 3:114874101-114874123 GACATAGGCTTAAAAAGAAAAGG + Intronic
960264919 3:115610119-115610141 TGAATAGGATGAGGAAGATAAGG + Intergenic
960300864 3:116000894-116000916 GAAATAGAATGAGAGATAAAAGG - Intronic
960364303 3:116752238-116752260 GGAAAAGGAGGAGAAGGAAAAGG + Intronic
960396692 3:117146350-117146372 GAAAGAGAGAGAGAAAGAAAAGG - Intergenic
960453428 3:117839689-117839711 AAAATAAGACTAGAAAGAAATGG + Intergenic
960503729 3:118468026-118468048 GCAATGGGCTGAGAAGGAAAAGG + Intergenic
960677614 3:120211979-120212001 GAAAGAGGAAGAGGAAGAAGAGG - Intronic
960832789 3:121867430-121867452 GAAATAGGATGTTAACCAAATGG - Intronic
961037176 3:123650617-123650639 AAAAAAGGATGAGATAGACAGGG + Intronic
961135066 3:124502492-124502514 GAAATGTGATGTAAAAGAAAGGG + Intronic
961338847 3:126203765-126203787 GATGTAGGCTGAGAAAGAGAAGG + Intergenic
961426768 3:126854684-126854706 GAAATAGGGGGAAAAAGGAAAGG - Intronic
961621781 3:128230062-128230084 GAAAGCGGGCGAGAAAGAAAAGG - Intronic
962100600 3:132338348-132338370 AAAAAAGGAAAAGAAAGAAAAGG - Intronic
962746481 3:138400760-138400782 GAAAAAGCAAAAGAAAGAAATGG - Intronic
962804668 3:138918151-138918173 GAAGGAGGAGGAGAAAGAGAAGG - Intergenic
962928867 3:140019479-140019501 GAAAAAGAGTGAGAGAGAAAGGG - Intronic
963006657 3:140732541-140732563 GAAAGAGGAGGAGAAGGAGAAGG - Intergenic
963029140 3:140949974-140949996 GAAAAAGCAAGAGAAAAAAATGG - Intronic
963467991 3:145706922-145706944 GAAAGAGGATGTCAAAGAAGGGG + Intergenic
963656051 3:148051923-148051945 GCAATAAGAAAAGAAAGAAAAGG + Intergenic
963927519 3:150966631-150966653 GAAATTGCATGTTAAAGAAAGGG - Intronic
964269195 3:154936883-154936905 AAAATAGGATGAGAAGGAAAAGG - Intergenic
964310031 3:155382675-155382697 GAAAAAGGACTGGAAAGAAATGG + Intronic
964384311 3:156131051-156131073 GAGCTAGGATGAGAAGGAGATGG - Intronic
964653349 3:159037407-159037429 GAAATGAGATGATAAATAAATGG - Intronic
964762961 3:160151979-160152001 GAAATGGGAAGAGAAAGATGTGG + Intergenic
964836013 3:160939546-160939568 AGAATAGCATGAGAAAGACAGGG - Intronic
964954264 3:162333376-162333398 GAAAACAGATTAGAAAGAAATGG + Intergenic
965177398 3:165352967-165352989 TAAATAGGATGAAATAGACAGGG + Intergenic
965257869 3:166439885-166439907 AAAAAAGAATGTGAAAGAAAGGG - Intergenic
965451670 3:168845939-168845961 GGAAGAGGAAGAGAAAGAGAAGG - Intergenic
965451699 3:168846122-168846144 GGAAAAGGAAGAGAAAGAAGAGG - Intergenic
965761172 3:172078591-172078613 AAGCTAGGATGAAAAAGAAAAGG - Intronic
966645315 3:182239742-182239764 AAATTAGAGTGAGAAAGAAAAGG + Intergenic
966667641 3:182490010-182490032 GATAGAGGATGAAAAAGAGAAGG + Intergenic
966836123 3:184050784-184050806 GAAAGAGAAAGAGAAAGAGAAGG - Intergenic
967062494 3:185884538-185884560 GAAATATGGCCAGAAAGAAAAGG + Intergenic
967179346 3:186889865-186889887 GAAGAAGGAGGAGAAGGAAAAGG - Intergenic
967238229 3:187409428-187409450 GAAACAGGATAAGAGGGAAAAGG + Intergenic
967260418 3:187636043-187636065 GCAAGAGGAAGAGAGAGAAAGGG + Intergenic
967385947 3:188911029-188911051 GAAGAGGCATGAGAAAGAAAGGG - Intergenic
967520260 3:190422576-190422598 GACTTAGGATGACAATGAAAGGG - Intergenic
968141048 3:196257048-196257070 GAAAAAGGATTGGAAAAAAAGGG + Intronic
969213193 4:5703837-5703859 GAAATAGGAACAGAGAGTAATGG + Intronic
969495325 4:7523067-7523089 GAAATGGGAAGAGGAAGGAAAGG - Intronic
969586161 4:8094974-8094996 GGAAAAGAAAGAGAAAGAAAGGG - Intronic
969984765 4:11196862-11196884 GAAATAGGATGACAAAGTAATGG + Intergenic
970420264 4:15899310-15899332 GAAAAAGGAGGAGAAGGAGAGGG - Intergenic
970456863 4:16232347-16232369 GAAACAAGAGGAGAAAGAAAAGG - Intergenic
970884675 4:20974375-20974397 GAATTCAGATTAGAAAGAAAGGG + Intronic
970926250 4:21455732-21455754 CAGAGAGGATGAGAAAGAAAGGG - Intronic
971049462 4:22844901-22844923 GAAATAGGATAGGATAGAATAGG + Intergenic
971104533 4:23508341-23508363 GAACAAAGATGAGAAAGACAGGG + Intergenic
971177885 4:24298191-24298213 AAAAAAAGATAAGAAAGAAAAGG + Intergenic
971369267 4:26002761-26002783 CAGATATGATGAGAAAGGAAGGG + Intergenic
971375168 4:26050388-26050410 GAAAGAGGAAGGGAAAGAAAGGG - Intergenic
971792116 4:31183329-31183351 TAAAGAGGATCAGAAGGAAAAGG + Intergenic
971839965 4:31838250-31838272 GAAATAGGAGTAGATAGAATGGG - Intergenic
972001043 4:34033622-34033644 GAATTAGGAAGAGAGAAAAATGG - Intergenic
972037371 4:34543117-34543139 GAAAATGGAAGGGAAAGAAAAGG + Intergenic
972039670 4:34577125-34577147 GGAAGAGGATCAGCAAGAAACGG - Intergenic
972054796 4:34786485-34786507 ATAATATGATGAGAAATAAATGG + Intergenic
972055533 4:34797225-34797247 GAAAAAGAAAGAGAAAGAAAAGG - Intergenic
972204155 4:36751014-36751036 TGAATAGGATGAGAAACAGAGGG + Intergenic
972454570 4:39241025-39241047 GATACAGTATGAGAAAGAAACGG - Intronic
972645325 4:40962702-40962724 GAAAGAGGAGGACAAAGAAGTGG + Intronic
972713547 4:41623156-41623178 GAAGTATCATGAAAAAGAAAAGG + Intronic
972761264 4:42106772-42106794 AAAAAAGGAAGAGGAAGAAAGGG - Intergenic
973119044 4:46494930-46494952 GAAATAGGATTAGAACAAGAGGG - Intergenic
973124454 4:46566965-46566987 GGAAAAGGACGAGAGAGAAAAGG + Intergenic
973153161 4:46913032-46913054 GAAAAAAGATGAGAGATAAAAGG + Intergenic
973624955 4:52762393-52762415 GAAAGGCGAGGAGAAAGAAAGGG - Intergenic
973655397 4:53042675-53042697 AAAATAGGTTGGGGAAGAAAAGG - Intronic
973688346 4:53398237-53398259 GCAATGGGAACAGAAAGAAATGG - Intronic
973835573 4:54806174-54806196 GAAAGAGGGAAAGAAAGAAAGGG + Intergenic
973895661 4:55410102-55410124 GAAATAAGAAGAAAGAGAAAAGG - Intronic
974093692 4:57339078-57339100 GAGAAAGGAAGAGAAAGGAAGGG - Intergenic
974200365 4:58630636-58630658 GAGAAAGGATGTGAAAAAAATGG + Intergenic
974419085 4:61648040-61648062 GAATTATTATGAGAAATAAAAGG - Intronic
974675370 4:65080892-65080914 GAAATATAATGTGAAAGGAAAGG + Intergenic
975074719 4:70191297-70191319 GAAAAAGGAAGAGAAGCAAATGG + Intergenic
975300466 4:72784319-72784341 AAAATAGGAAGAGAAAAGAAGGG - Intergenic
975483141 4:74904651-74904673 GAAATAGAAAGAGAATGAACTGG - Intergenic
975533720 4:75426983-75427005 GAAACAGGAGGAGATAGAAGAGG - Intergenic
975697647 4:77029644-77029666 GAAAGAAAATGAAAAAGAAAAGG - Intronic
976559146 4:86480911-86480933 GAAATATGATTAGACAAAAAGGG + Intronic
976777189 4:88719603-88719625 GAAGGAGGAGGAGAAAGAGAAGG - Intergenic
976804503 4:89031601-89031623 GAAAGAGGAGGAGAAGGAAAAGG - Intronic
976940359 4:90693907-90693929 GAAAGAGGAGGAGAGAGAGAGGG + Intronic
977091176 4:92677673-92677695 GATATATCATGAGAGAGAAAGGG - Intronic
977307981 4:95349301-95349323 TAAAAAGAATGAGAGAGAAAGGG + Intronic
977421558 4:96807180-96807202 GAAAGAGAAGGAGAAAGAGAGGG + Intergenic
977451827 4:97208620-97208642 GAAATGGGAGAAGAAAGGAAAGG + Intronic
977654634 4:99506490-99506512 GAAAGAGAAAGAGAAAGAAAGGG - Intergenic
977688920 4:99880713-99880735 GAAATATGATGAGACATGAATGG + Exonic
977705147 4:100062333-100062355 GAAAAAGGAAAAAAAAGAAAGGG - Intergenic
977708719 4:100100171-100100193 AACATAGGGTGAGAAAGAAATGG - Intergenic
977725296 4:100289597-100289619 GAAAGAGAAGGACAAAGAAAAGG + Intergenic
977758281 4:100699787-100699809 GAAATAGGAATGGAAAGAAAGGG + Intronic
977919241 4:102625372-102625394 GAAGAAGAATGAGAGAGAAAAGG - Intergenic
978108006 4:104928145-104928167 GAAAAAGAAAGAGAAAGGAAAGG + Intergenic
978263742 4:106795986-106796008 GAAATAGGATGAGAAAGAATAGG - Intergenic
978344137 4:107748718-107748740 GAAAGAGGATGAGGAGGAGAAGG - Intergenic
978390576 4:108221046-108221068 GAAATAAAATGAGTAATAAATGG - Intergenic
978404937 4:108369224-108369246 GAAGTGGGATGAGAACTAAAGGG + Intergenic
978421951 4:108542532-108542554 GAGAAAGGGAGAGAAAGAAATGG - Intergenic
978631039 4:110744830-110744852 GAAATAATAGGAGAGAGAAAAGG - Intergenic
978855773 4:113393041-113393063 GAAATAGGATGGGGAATCAATGG + Intergenic
979035684 4:115713779-115713801 GGAAAAGGATGAGGGAGAAAGGG + Intergenic
979348309 4:119615448-119615470 GAAAAAGGATGAGAGTAAAAAGG + Intronic
979513036 4:121575583-121575605 GAAAAAGGAAAAGAAAGGAAAGG + Intergenic
979689554 4:123546291-123546313 GTAATACTATGAGAAGGAAATGG - Intergenic
979708357 4:123748223-123748245 CAAAAAGGATGAGAAGGAGAAGG - Intergenic
979800953 4:124908250-124908272 GAAATAGCCAGACAAAGAAATGG - Intergenic
979880659 4:125955215-125955237 TAAATAGTATGAGAAAGAAAAGG - Intergenic
980168649 4:129259785-129259807 CAATTAGTAGGAGAAAGAAAAGG + Intergenic
980264248 4:130494543-130494565 GAGATAGCATGAGAGAGAAGAGG + Intergenic
980372147 4:131889259-131889281 GAATTTGAATCAGAAAGAAAGGG - Intergenic
980851796 4:138391574-138391596 GAAATATGATCAGAGAGACAAGG + Intergenic
981020751 4:140025594-140025616 GAAAAAGAATAAGAAATAAAGGG + Intronic
981120044 4:141039362-141039384 GAAGGAGGTAGAGAAAGAAAGGG + Intronic
981121660 4:141058265-141058287 GGAAGGGGAGGAGAAAGAAAGGG + Intronic
981352076 4:143742932-143742954 GAAATAGAAAGAGACAGACAAGG + Intergenic
981878731 4:149581487-149581509 GAAAGAGGTAGAGAAAGAACAGG + Intergenic
982696276 4:158605188-158605210 GAAGTAGGAAGAAAAAGACATGG - Intronic
982828858 4:160034465-160034487 GAAAAGAGATTAGAAAGAAAAGG - Intergenic
982857223 4:160399106-160399128 GAGATTGGAAGAGAAAGAAGAGG - Intergenic
982901744 4:161013284-161013306 GAGATAGAATGAGAGAGATAGGG - Intergenic
982937698 4:161504732-161504754 GAAATGGACTGAGAAAAAAATGG + Intronic
982941232 4:161559353-161559375 GAAATAGAAGGAGAAAGCAAAGG - Intronic
982959588 4:161820499-161820521 GATCTAGGAAGAAAAAGAAATGG - Intronic
983413800 4:167429700-167429722 TTAAAAGGAAGAGAAAGAAAAGG + Intergenic
983756459 4:171343189-171343211 GAAGTAGGATGATAAAGTCAAGG + Intergenic
983760973 4:171406240-171406262 GAAAATGTATGAGAAGGAAATGG - Intergenic
983833215 4:172357543-172357565 GAAAAAAGATGAGAAAATAAAGG - Intronic
984214117 4:176887135-176887157 GAAAGAGAGAGAGAAAGAAAGGG - Intergenic
984329335 4:178295581-178295603 GCAAAAGGATGAGAAAGAGCTGG - Intergenic
984378387 4:178960625-178960647 AAGACAGGATGACAAAGAAAAGG - Intergenic
984568618 4:181362591-181362613 GAAAGAGAATGAGAAAAAGAGGG + Intergenic
984680488 4:182602643-182602665 AAATTAGGAAGAGAAAGAACAGG + Intronic
984692799 4:182747116-182747138 GTCATAGGAAGAAAAAGAAATGG + Intronic
985091336 4:186365234-186365256 TACAAAGGATGACAAAGAAATGG - Intergenic
985282776 4:188303482-188303504 GAAATAGCAGGAGAAAGGACGGG + Intergenic
985361439 4:189179706-189179728 GAAATAGGATTAAACAAAAAGGG + Intergenic
985362863 4:189193837-189193859 GAAATAGGAAGAGACAGCAAAGG + Intergenic
985381081 4:189395566-189395588 GAAATAGAGTCAGAAAGAGAAGG - Intergenic
985840821 5:2303989-2304011 GAAAAAGGAAAAGAAAGAAATGG + Intergenic
985897312 5:2756418-2756440 GAAGGAGGAGGAGAGAGAAAAGG - Intergenic
986703175 5:10431434-10431456 GATAGAGCATGAGAAAGAAGAGG - Intronic
987079743 5:14416070-14416092 AAAATATGGTTAGAAAGAAAAGG + Intronic
987170040 5:15245589-15245611 CATATAAGATGAGAAGGAAATGG + Intergenic
987175090 5:15299909-15299931 GAAATAGAATAATACAGAAATGG + Intergenic
987347732 5:16993483-16993505 GAAGAAAAATGAGAAAGAAAAGG + Intergenic
987521586 5:18992716-18992738 AAAACATGATGATAAAGAAATGG - Intergenic
987563114 5:19549800-19549822 GAAAAAGAAAGAAAAAGAAAGGG + Intronic
987580725 5:19787997-19788019 GAAAGAGAAAGAGAAAGAAAAGG - Intronic
987746211 5:21975406-21975428 GAGAGAGGAAGAGAAAGAGAAGG + Intronic
987765617 5:22225587-22225609 AAAATAAGAGGAGAAAGAAAAGG - Intronic
987814177 5:22879257-22879279 TAAAAAGAATGGGAAAGAAATGG - Intergenic
987843913 5:23256926-23256948 AAGATGGGATAAGAAAGAAATGG + Intergenic
987908028 5:24104844-24104866 GAAATAGGAATGGAAAGATAAGG - Intronic
988273851 5:29054882-29054904 GACATAGGATAAGAAACAGAGGG - Intergenic
988323544 5:29732644-29732666 GTAATAGTAAAAGAAAGAAAAGG + Intergenic
988363402 5:30265179-30265201 GAAATAGGATAAAAGAGATAGGG + Intergenic
988377437 5:30455447-30455469 GAACAAGGAAGAGAAAAAAATGG + Intergenic
988427658 5:31082001-31082023 GAAAGAGAAAGAGAAAGAGAAGG + Intergenic
988660020 5:33255754-33255776 GAAGTAGGATTAGGGAGAAAGGG - Intergenic
988672314 5:33395092-33395114 GAAATAAGCTGAGAATGGAAAGG - Intergenic
988688902 5:33552175-33552197 AAAATAGCACAAGAAAGAAAAGG - Intronic
988955561 5:36313264-36313286 GAAATAGGAATAGAAAGAGAAGG + Intergenic
989108138 5:37882537-37882559 GAAAGAGAGGGAGAAAGAAAGGG + Intergenic
989262323 5:39432078-39432100 GAAGTAGGGAGATAAAGAAAAGG + Intronic
989574269 5:42974859-42974881 GAAAGAGGGAGAGACAGAAAGGG + Intergenic
989654930 5:43736338-43736360 GAAGTATGAAGAGATAGAAATGG + Intergenic
990048240 5:51461518-51461540 GAGAGAGGATGATGAAGAAAGGG + Intergenic
990099992 5:52170878-52170900 GGAAAAGGAGGAGGAAGAAAAGG - Intergenic
990136872 5:52655963-52655985 GAAATGGAAAGAGAGAGAAAAGG + Intergenic
990207676 5:53447387-53447409 GAAATTTAATGAGAAAAAAATGG - Intergenic
990381401 5:55224498-55224520 GAAAGGAGATGAGAAAGGAAGGG + Intronic
990440613 5:55841268-55841290 TAAATTGATTGAGAAAGAAAAGG - Intergenic
990489657 5:56292118-56292140 AAAATAGGGTAAGAGAGAAAAGG - Intergenic
990529223 5:56657178-56657200 GAAATTGGATAGGAAAAAAAGGG - Intergenic
990625795 5:57609576-57609598 GAAATAGAATGAAAAACAATAGG + Intergenic
990644037 5:57823164-57823186 GAACTAGGATGAGGTACAAAAGG - Intergenic
990721656 5:58702617-58702639 GGAAGAGGAGGAGAAAGAGAAGG - Intronic
990867412 5:60395678-60395700 GAAAAAGAAAGAGAAATAAAAGG - Intronic
990996975 5:61742435-61742457 GAGAGAGAAGGAGAAAGAAAGGG - Intronic
991146733 5:63315598-63315620 GAAATTGTAAGAAAAAGAAAAGG - Intergenic
991401437 5:66255911-66255933 GAAAGAGAAAGAGAGAGAAAAGG - Intergenic
991461464 5:66863597-66863619 GAAAAAGGAAGAAGAAGAAAGGG - Intronic
991717326 5:69464031-69464053 GAGACAGAATGAGAAAGAGAAGG + Intergenic
991722116 5:69503362-69503384 GATGGAGGATGAGTAAGAAAAGG - Intronic
991766419 5:69985517-69985539 GAGAGAGGAAGAGAAAGAGAAGG + Intergenic
991780899 5:70132636-70132658 GAGAGAGGAAGAGAAAGAGAAGG - Intergenic
991845652 5:70860600-70860622 GAGAGAGGAAGAGAAAGAGAAGG + Intergenic
991873345 5:71132950-71132972 GAGAGAGGAAGAGAAAGAGAAGG - Intergenic
991978382 5:72205622-72205644 GAGAAAGAATGAGAAAGAAAAGG + Exonic
992010915 5:72526484-72526506 GAAAAAGAAAAAGAAAGAAAAGG + Intergenic
992079553 5:73222138-73222160 TAAATAGGAAGAGAGAGAAAAGG - Intergenic
992159799 5:73990184-73990206 GAAATTTGATAAGAAAGATAAGG - Intergenic
992263645 5:74995259-74995281 GAAATAAGATCAGAAATCAATGG - Intergenic
992829370 5:80579319-80579341 GAAAGAGAAAGAGAAAGAAAGGG + Intergenic
993250878 5:85520706-85520728 AAAAGAGCAAGAGAAAGAAATGG - Intergenic
993275589 5:85852436-85852458 GAAATAAAATGAAACAGAAAGGG - Intergenic
993292362 5:86090977-86090999 TAAATAAAATGAGAAAGAAAAGG - Intergenic
993373167 5:87117490-87117512 GGAATAGGATCTCAAAGAAAAGG + Intergenic
993617626 5:90133118-90133140 GAAAAAGAAAGAGAAATAAATGG - Intergenic
993636462 5:90350392-90350414 GAAAAAGCATGAGCATGAAATGG + Intergenic
993637815 5:90366488-90366510 GTAGGAGGATGAGAGAGAAAGGG - Intergenic
993931124 5:93941565-93941587 GACTTAGAAAGAGAAAGAAAGGG - Intronic
994170632 5:96656452-96656474 GAGATAGGAGGAGACAGAAGAGG - Intronic
994372708 5:98985423-98985445 GGAATAGGTTGAGAAAGGTAGGG + Intergenic
994696881 5:103083222-103083244 GAAAGAGGAAGAGAGGGAAAAGG - Intergenic
994857326 5:105140100-105140122 GAGAGAGAAAGAGAAAGAAAGGG - Intergenic
995065084 5:107852450-107852472 GAAATAGGACTGGGAAGAAATGG + Intergenic
995074849 5:107970536-107970558 AAAATAAGAGCAGAAAGAAAAGG + Intronic
995159492 5:108961981-108962003 TAAATGGGAAGAGAAATAAATGG - Intronic
995313506 5:110739497-110739519 GCGATAGGATGAGAAGGAATAGG - Intronic
995319477 5:110816508-110816530 TACATAGCATGAGAAAGCAAAGG - Intergenic
995370611 5:111414572-111414594 GAAATAGAATAAAATAGAAAAGG + Intronic
995419909 5:111952706-111952728 GGAACAGGATGAAAAAGAAGAGG + Intronic
995616698 5:113972610-113972632 AAAATAGGATGAGGACAAAAAGG - Intergenic
995883536 5:116868595-116868617 GAAATAGGATGTGGAGTAAATGG - Intergenic
996092870 5:119367825-119367847 GAAAAAAAATGAGAAAGCAAAGG - Intronic
996179588 5:120402249-120402271 GAAATAGCATCAGGAACAAAAGG + Intergenic
996309986 5:122093572-122093594 GAAGGAAGATGAGAGAGAAAGGG + Intergenic
996408447 5:123129979-123130001 GAAATGGGAAGGGAAAGTAAAGG - Intronic
996464322 5:123782076-123782098 GAAAAAGGAAGAGAGAGAAGCGG - Intergenic
996519837 5:124414304-124414326 GAGTGAAGATGAGAAAGAAAGGG - Intergenic
996711363 5:126546628-126546650 GAAATGGAAACAGAAAGAAACGG + Intronic
996729123 5:126700248-126700270 GAAAAAGAAAGAGAAAGAAAAGG - Intergenic
996884746 5:128341702-128341724 GAAGTGGGCAGAGAAAGAAATGG - Intronic
997272849 5:132556627-132556649 GAGAGAGAATGAGAATGAAAAGG + Intronic
997413541 5:133708103-133708125 GAAAGGGGAAGAGAAAGAGAAGG + Intergenic
997507497 5:134429482-134429504 GAGACAGGATCAGAGAGAAAGGG + Intergenic
997902012 5:137775402-137775424 GAATGAGGAGGAGAAAGAAGAGG + Intergenic
997921408 5:137982659-137982681 CAAAGAGGATGATAAATAAAGGG - Intronic
997963645 5:138340614-138340636 CAAATGGGAAGATAAAGAAATGG - Intronic
998126988 5:139630980-139631002 GGGAAAGGAAGAGAAAGAAAGGG - Intergenic
998149140 5:139747116-139747138 GAGACAGGCAGAGAAAGAAATGG - Intergenic
998404661 5:141867570-141867592 AAAAGAGACTGAGAAAGAAAAGG - Intronic
998603111 5:143604988-143605010 GAGAAAGAATGGGAAAGAAATGG + Intergenic
998772275 5:145559576-145559598 GTCATGGGATGAGAAAGAAGTGG - Intronic
998772947 5:145566865-145566887 GCAAGAGAAAGAGAAAGAAAAGG + Intronic
998808771 5:145944513-145944535 TAAATAGAAGGAGAAAGGAAGGG - Intronic
998965337 5:147533985-147534007 AAAGTAGGAGGAGAAAAAAAAGG + Intergenic
999117622 5:149177586-149177608 GAGATAGGGGGAGAAAGAAGAGG + Intronic
999500952 5:152146262-152146284 GAAATAGGACAAGAAAGAGGAGG - Intergenic
999544281 5:152609689-152609711 AAAATAGGATCACAAAGAACAGG - Intergenic
999551699 5:152694580-152694602 AAAATAGGAGGAGGAAGAAGTGG - Intergenic
999805173 5:155074378-155074400 GAAATAGGATTTGACAAAAAGGG + Intergenic
999875036 5:155795219-155795241 TAAATAGAATGAGAAATACATGG + Intergenic
999891352 5:155981584-155981606 GAAATAGGTTGAAAACGTAAAGG - Intronic
1000427460 5:161108860-161108882 TCAATAAGATGAGAAAGAATAGG + Intergenic
1000428386 5:161119751-161119773 GAATTGGGATGATAAAGCAATGG - Intergenic
1000467661 5:161600119-161600141 GAAGTAGAAAGAGAAATAAAAGG + Intronic
1000526321 5:162362873-162362895 GAAATAAGAGGAAGAAGAAAAGG + Intergenic
1000579857 5:163022851-163022873 GAAAGAGAAAGAGAAAGAAAGGG + Intergenic
1000579859 5:163022867-163022889 GAAAGGGAAAGAGAAAGAAAGGG + Intergenic
1000579861 5:163022883-163022905 GAAAGGGAAAGAGAAAGAAAGGG + Intergenic
1000620482 5:163479790-163479812 GAAAAAGGAGGAGAAGGAAAAGG - Intronic
1000727188 5:164785870-164785892 GAAGCAAGATGAGAAAGAGAAGG + Intergenic
1000796602 5:165672061-165672083 GAAGGAGCATGAGAGAGAAAGGG - Intergenic
1000827151 5:166059070-166059092 AAAATAGTCTGAGAAAGAAAAGG - Intergenic
1001000758 5:168004739-168004761 GAGAGAGGAGGAAAAAGAAACGG - Intronic
1001011529 5:168103400-168103422 GATCCTGGATGAGAAAGAAAGGG - Intronic
1001454653 5:171851475-171851497 GAAATAGCAAGTTAAAGAAAAGG - Intergenic
1002255087 5:177952683-177952705 GTGAGAGAATGAGAAAGAAAAGG + Intergenic
1002464033 5:179395503-179395525 GAGAGAGCAAGAGAAAGAAAGGG + Intergenic
1002482995 5:179515725-179515747 GTGAGAGGATGAGAAAGAAAAGG - Intergenic
1002547273 5:179957740-179957762 TAAATACCAAGAGAAAGAAAAGG + Intronic
1002791334 6:440326-440348 GGGATAGGATTAGAAGGAAAGGG - Intergenic
1002822482 6:739051-739073 GAAAGAGAAAAAGAAAGAAAGGG - Intergenic
1002867359 6:1133650-1133672 GAAAAAGGATGAGAATGTGAGGG - Intergenic
1002891241 6:1334485-1334507 GAAAAAGGAGGAGAAAACAAAGG + Intergenic
1003047428 6:2746696-2746718 GAGAAGGGATGAGAGAGAAAGGG + Intronic
1003271590 6:4612526-4612548 AAAATGAGAGGAGAAAGAAAAGG + Intergenic
1003473901 6:6463571-6463593 GCAGTAGGATGAGAAAGTATAGG + Intergenic
1003604600 6:7547872-7547894 GAAAGAGGAAAAGGAAGAAATGG - Intronic
1003623187 6:7720415-7720437 GAAATTGGATCAGAAAGCCAAGG - Intergenic
1003931142 6:10925740-10925762 GGATGAGGATGAGAAATAAAGGG + Intronic
1004132712 6:12935749-12935771 GAAATACAATAAGAAAGAAAGGG - Intronic
1004147093 6:13077949-13077971 GAATTAAGATGAGAAAAGAAGGG + Intronic
1004160828 6:13211434-13211456 GAATTAAGATCAGAAAGAAACGG - Intronic
1004242238 6:13934943-13934965 GAAATGCGGTTAGAAAGAAAAGG + Intronic
1004559241 6:16731740-16731762 GAAAGAGGCGGAGAAGGAAACGG - Intronic
1004566281 6:16801121-16801143 GGAATATGATAAGACAGAAATGG - Intergenic
1004649323 6:17593466-17593488 GAAAAAAGAGAAGAAAGAAAAGG - Intergenic
1004698800 6:18059181-18059203 GAAAGAGGATGAGCAAGAGGAGG - Intergenic
1004861654 6:19809648-19809670 GACATAGGACAAGAATGAAAGGG - Intergenic
1005023938 6:21445034-21445056 GAAAGAGGAAGAGAAAGAATGGG + Intergenic
1005043331 6:21619079-21619101 GAACTTGCATGAGGAAGAAAAGG - Intergenic
1005245769 6:23883301-23883323 GCAATCTGATGAGACAGAAAAGG + Intergenic
1005362209 6:25041664-25041686 GAAATAGGAAGAGAGAGAGTCGG + Intronic
1005409870 6:25533041-25533063 GAAAGAGAGAGAGAAAGAAAGGG + Intronic
1005604375 6:27461322-27461344 AAAAGAGGATCAGAAGGAAAAGG - Intronic
1005822584 6:29609714-29609736 AAAATGGGAGGAGAAAGAAGGGG + Intronic
1005891571 6:30144504-30144526 GACATAGTCTGAGATAGAAAAGG + Intronic
1005940066 6:30554230-30554252 GAAATGAGATAAGGAAGAAAGGG + Intronic
1005998123 6:30944246-30944268 GAAAGAGAAAGGGAAAGAAAAGG - Intronic
1006176814 6:32127555-32127577 GAGAAAGGATGAGAAAGTAGGGG + Intronic
1006326688 6:33359504-33359526 GAAATATAAAGAGAAGGAAATGG + Intergenic
1006516535 6:34548738-34548760 GAATTGTGATGAGAAGGAAAGGG - Intronic
1007218891 6:40262867-40262889 GGAAAAGGAGGAGAAAGACAGGG + Intergenic
1007423113 6:41731484-41731506 GAAAAAGGAAGAGAAAGCAAGGG - Intronic
1007870419 6:45030342-45030364 GAAGTAAGCTGAGAAAGAAGAGG - Intronic
1007923538 6:45632104-45632126 CAAATGGGACAAGAAAGAAATGG - Intronic
1007969940 6:46041492-46041514 GAACTGGGATGAGCAATAAAAGG - Intronic
1008150960 6:47950470-47950492 GATATTGGATGAGAAAGATGAGG + Intronic
1008248163 6:49204430-49204452 AAAAGAGGAAGAGAAGGAAAAGG - Intergenic
1008405905 6:51118209-51118231 GAACTGAGATGAGGAAGAAACGG - Intergenic
1008654772 6:53600720-53600742 GAAAAAGAAGGAGAAAGAGAAGG + Intronic
1008717861 6:54310775-54310797 AAAAAAGAAAGAGAAAGAAAGGG - Intronic
1008892907 6:56516177-56516199 GAAAGAGAAAGAGAAAGAGAAGG + Intronic
1009397426 6:63215563-63215585 TAAAGAGGAAAAGAAAGAAAAGG + Intergenic
1009652815 6:66498432-66498454 GAAGTAGGAGGAGAAAGAGGAGG + Intergenic
1009667407 6:66702664-66702686 GAAATAGGAAGAAAAGAAAAGGG - Intergenic
1009866804 6:69408127-69408149 AATATAGTTTGAGAAAGAAAAGG - Intergenic
1010159379 6:72834043-72834065 GGAATAGGATGGGGAAGAAAAGG + Intronic
1010233615 6:73556861-73556883 AAGATAGGATCAGCAAGAAAAGG - Intergenic
1010284168 6:74055694-74055716 GGAAGAGGAGGAGAAAGAAAAGG + Intergenic
1010438296 6:75861641-75861663 GAGATGGGGTGGGAAAGAAATGG - Intronic
1010447201 6:75961598-75961620 GAAATAAAATGAGGCAGAAAAGG + Intronic
1010469250 6:76206385-76206407 GATTTATCATGAGAAAGAAATGG + Intergenic
1010544965 6:77141724-77141746 GAGCTAGGATCAGATAGAAATGG + Intergenic
1010754205 6:79648385-79648407 GAAATAGCATGAGAAAGGGATGG - Intronic
1010887356 6:81261431-81261453 AAAATAGGAGGAGAAGGAAAAGG + Intergenic
1010895514 6:81358352-81358374 GGAAGAGGAAGAGGAAGAAAGGG - Intergenic
1010933768 6:81835726-81835748 GGAACAGGAAGAGAAAGAGAGGG - Intergenic
1011262304 6:85482427-85482449 AAAAAAGAAAGAGAAAGAAAAGG + Intronic
1011609025 6:89132399-89132421 AAAAGAGAATGAGAAGGAAAAGG - Intergenic
1011652575 6:89520466-89520488 CACAGAGGATGAGAAAGATAGGG + Intronic
1011658621 6:89575007-89575029 GAAATATGATTGGACAGAAAGGG + Intronic
1012078251 6:94722810-94722832 GCAAGAGGAAGAAAAAGAAATGG + Intergenic
1012158909 6:95857569-95857591 GAAATAGAATTAGTAAGATAAGG - Intergenic
1012455601 6:99400905-99400927 GAAAAAGAAAGACAAAGAAAGGG - Exonic
1012658437 6:101855636-101855658 GGAATAAAATGAGAAAGAGAGGG + Intronic
1012661844 6:101908016-101908038 ACAGTAGGAAGAGAAAGAAAGGG - Intronic
1012844434 6:104371760-104371782 GAAAAAAGATGAGAAAAGAAAGG - Intergenic
1012935940 6:105367391-105367413 GAAGTTAGATGGGAAAGAAAAGG + Intronic
1012950473 6:105512867-105512889 GATATAGGGAAAGAAAGAAAGGG - Intergenic
1012951790 6:105525939-105525961 GGAAAAAGATGAGGAAGAAAAGG + Intergenic
1012994402 6:105959216-105959238 GAAATAGCGTGAGCAAGAAATGG + Intergenic
1013026499 6:106278629-106278651 GAAATTTGAATAGAAAGAAATGG - Intronic
1013237003 6:108206001-108206023 GAAATGGGAAGAGAAAGAGTAGG - Intergenic
1013271547 6:108550115-108550137 TAAATAGGATGAGAACCACAGGG + Intergenic
1013753924 6:113438830-113438852 AAAATGGAATGAGAAAGAGAGGG - Intergenic
1014028551 6:116676078-116676100 TAAGGAGGATGAGAAAGAAGAGG + Intergenic
1014100298 6:117504431-117504453 GAGAGATGGTGAGAAAGAAAAGG + Intronic
1014296256 6:119621176-119621198 TACATAGGAGGAGAAAAAAATGG + Intergenic
1014474391 6:121854458-121854480 GAAAGAGGATGAGAGGGAGAAGG - Intergenic
1014528086 6:122524284-122524306 GAAAGAGGATGAGGAGGAGAAGG - Intronic
1014545138 6:122726400-122726422 GAAGTAGGCTGAGTAAAAAATGG + Intergenic
1014617290 6:123618823-123618845 GGAAGAGGATGAGAAAGAGGAGG - Intronic
1014888785 6:126816218-126816240 GAAAGAGAAAGAAAAAGAAAAGG - Intergenic
1014988524 6:128044318-128044340 GAAGTGGCATGAGAGAGAAATGG - Intronic
1015057751 6:128924412-128924434 GAAAGAGGAAGAGAAGGAAGAGG + Intronic
1015088988 6:129331293-129331315 GAAAAAGGATGAGAGAAAAGTGG - Intronic
1015090374 6:129349279-129349301 GAAACTGAATCAGAAAGAAAAGG - Exonic
1015221859 6:130813333-130813355 GCAATAGGCTGTGACAGAAATGG - Intergenic
1015393330 6:132708615-132708637 GATGTAGGATGTGAGAGAAAAGG - Intronic
1015416058 6:132949880-132949902 GAGAGAGGAGAAGAAAGAAAGGG + Intergenic
1015540050 6:134304711-134304733 GAGAGAGAAAGAGAAAGAAAAGG + Intronic
1015571344 6:134624422-134624444 GAAAAAGAAAGAGAAAGAAAAGG - Intergenic
1015616475 6:135081182-135081204 GAAAGAGAGAGAGAAAGAAACGG - Intronic
1015663492 6:135602296-135602318 GAAAAAGGATGAGAAATACATGG - Intergenic
1016098700 6:140070373-140070395 GAGAAAGGATTAGAAAGCAAGGG - Intergenic
1016107746 6:140184087-140184109 GCAAAAGGATGAGCAACAAAAGG - Intergenic
1016233400 6:141832800-141832822 GACAGAGGAGGAAAAAGAAAAGG - Intergenic
1016287544 6:142490124-142490146 GAGAGAGGGAGAGAAAGAAAAGG - Intergenic
1016324496 6:142884645-142884667 GAGACAGGAAGAGAAAGAAGAGG + Intronic
1016324497 6:142884660-142884682 AGAAGAGGAAGAGAAAGAAAAGG + Intronic
1017086992 6:150722737-150722759 GAAAAAGGAGGAGGAAGAAGAGG - Intronic
1017155314 6:151317564-151317586 TAAAGAGTCTGAGAAAGAAATGG - Intronic
1017322113 6:153106163-153106185 GTAAGAGTATGAGAAGGAAAGGG + Intronic
1017363593 6:153605407-153605429 GATATCAGATGAGCAAGAAATGG - Intergenic
1017939933 6:159043094-159043116 GAAGCATGATGAGAAAGAAGTGG + Intronic
1018512284 6:164537959-164537981 GAAACAGGAAGAGAAAGGCAGGG - Intergenic
1018571224 6:165212077-165212099 AGAACAGGAGGAGAAAGAAATGG - Intergenic
1018858417 6:167692163-167692185 GAAAGAGAAAGAGAAGGAAAGGG + Intergenic
1018897128 6:168027542-168027564 GAAAAAGAATGAGAATGACAGGG + Intronic
1018927513 6:168216824-168216846 GACAAAGGATGGGAAAGAAATGG - Intergenic
1018938022 6:168286487-168286509 GAAATAAAAAAAGAAAGAAAAGG - Intergenic
1019465930 7:1188962-1188984 GAAAGAGGAAGAGGAAGAAGAGG + Intergenic
1019944625 7:4316809-4316831 GAAAGGGAAAGAGAAAGAAAAGG + Intergenic
1020377420 7:7503801-7503823 GAACTATGACTAGAAAGAAAAGG + Intronic
1020468949 7:8513672-8513694 GAGATAGGATGAAAAAGGTAAGG + Intronic
1020531219 7:9338336-9338358 GAACTAAGAAGAGAAATAAAGGG - Intergenic
1020589861 7:10121800-10121822 GAAATAGCAATAGAAAGAAGAGG - Intergenic
1020606843 7:10349003-10349025 CAAATAGGGTGAGAAAGAAAGGG + Intergenic
1020661011 7:10982607-10982629 GAAAGAGAAGGAAAAAGAAAAGG + Exonic
1020743107 7:12047066-12047088 GGAAGAGGATGAGAATGAAGAGG - Intergenic
1020766744 7:12331552-12331574 GAAAGAGGTGGAGAAAGAAAAGG - Intronic
1020939312 7:14510494-14510516 GAAATAGCAAGAATAAGAAATGG - Intronic
1021434213 7:20595854-20595876 AAAAGAGGAAGGGAAAGAAAGGG + Intergenic
1021650473 7:22828129-22828151 GAAAAAGAAAAAGAAAGAAAGGG + Intergenic
1021788584 7:24177214-24177236 GGAAAAGGAGGAGAAAGAAGAGG + Intergenic
1021900299 7:25278616-25278638 GAAAAAGGATTTGAAAAAAAAGG + Intergenic
1021910653 7:25383026-25383048 GAAATTGAATGGGAAAGTAAAGG + Intergenic
1022085232 7:27061153-27061175 GAAAGAGCATGGGGAAGAAAAGG + Intergenic
1022257928 7:28677908-28677930 GAAAGAGAGAGAGAAAGAAAGGG + Intronic
1022263364 7:28729136-28729158 CTAAAAGGATGAGAAAGACAAGG + Intronic
1022284583 7:28943257-28943279 GAAATAGGTGGGGAAAAAAAAGG + Intergenic
1022562747 7:31366578-31366600 GAAATATAATGAGAAAGAAAAGG - Intergenic
1022568523 7:31427958-31427980 GAAAAATAATGACAAAGAAATGG - Intergenic
1022571341 7:31457091-31457113 GAAATAGATCGAGAAAGAGACGG - Intergenic
1022572134 7:31465259-31465281 GAAAAAAGGTGAGACAGAAAAGG + Intergenic
1022599630 7:31745395-31745417 GATATAGTATGAAAAAGAAATGG + Intergenic
1022629931 7:32075588-32075610 GAAAAAAGAGGTGAAAGAAAAGG + Intronic
1022718093 7:32916664-32916686 GCAACAGGAAGAGGAAGAAAGGG + Intergenic
1022738010 7:33093927-33093949 GCAACAGGAAGAGGAAGAAAGGG + Intergenic
1022739246 7:33105762-33105784 GAAATATGATTAGACAAAAAAGG - Intronic
1022969436 7:35503981-35504003 GAAATATGATTGGACAGAAAGGG + Intergenic
1023269750 7:38449772-38449794 AAAATAGCAAGAGAAAGAAGAGG + Intronic
1023480158 7:40625486-40625508 GAAAGAGGAGGAGAAGGAAGAGG - Intronic
1024234804 7:47389892-47389914 GAAGTTGTATGAGACAGAAACGG - Intronic
1024737805 7:52323696-52323718 GAAAAAGGAAGAGAAGGGAAGGG - Intergenic
1024930559 7:54663742-54663764 GAAAGAGAAGGAGAAAGAGAAGG + Intergenic
1025296748 7:57781652-57781674 GAAAAAGAAAGAAAAAGAAACGG + Intergenic
1025623544 7:63197003-63197025 GAAATAAAATGAGAAAGTAACGG - Intergenic
1025874879 7:65471650-65471672 GAAAAAGGATAAAAAAGAAAGGG + Intergenic
1026138296 7:67682882-67682904 GCAATAGAATGTGGAAGAAATGG + Intergenic
1026245371 7:68615054-68615076 GAAAGAGGAGGAGAAGGAGAAGG + Intergenic
1026559925 7:71440210-71440232 GAAAAAGGAATAAAAAGAAAGGG - Intronic
1026616626 7:71910773-71910795 GAAACAAGCTGAGAAAAAAACGG - Intronic
1026638768 7:72106525-72106547 GAGAGAGGAAGAAAAAGAAAAGG + Intronic
1026760899 7:73125039-73125061 GAACAAGGATCAGAAAGACAAGG + Intergenic
1027037241 7:74933835-74933857 GAACAAGGATCAGAAAGACAAGG + Intergenic
1027086321 7:75267617-75267639 GAACAAGGATCAGAAAGACAAGG - Intergenic
1027276793 7:76565886-76565908 GAAATAAGAATAAAAAGAAACGG - Intergenic
1027711277 7:81604437-81604459 AAAATAGGTTGAGAAAGTAAGGG + Intergenic
1028090040 7:86688571-86688593 GAAAAAGCATACGAAAGAAAAGG + Intronic
1028246672 7:88487373-88487395 GAAAGAGGAGGAGAAGGAGAAGG + Intergenic
1028274027 7:88828993-88829015 GGAAGAGAAAGAGAAAGAAAAGG + Intronic
1028289461 7:89046363-89046385 GAAATAGAATGTCAAAGACATGG + Intronic
1028305507 7:89258882-89258904 GAAATAGGATGAAATAGTGAAGG + Intronic
1028311179 7:89338515-89338537 GAGAGAGAAAGAGAAAGAAAGGG + Intergenic
1028687043 7:93601952-93601974 AATAAAGGAAGAGAAAGAAAGGG + Intronic
1028696372 7:93717705-93717727 GAGAAAGAAAGAGAAAGAAAAGG + Intronic
1028733135 7:94176253-94176275 GATAAAGGAAGAAAAAGAAATGG - Intergenic
1029105884 7:98175315-98175337 GTAGGAGGAAGAGAAAGAAAGGG + Intronic
1029311313 7:99667619-99667641 TAAATAGAAGGAAAAAGAAAGGG + Intronic
1029392620 7:100285643-100285665 GAACAAGGATCAGAAAGACAAGG - Intergenic
1029455806 7:100671621-100671643 GAAAAAGTAAAAGAAAGAAAAGG - Intergenic
1029945488 7:104528421-104528443 AGAAAAGGATGAGAAAGAGAAGG - Intronic
1030011342 7:105171057-105171079 GAAAAAAGAAAAGAAAGAAAGGG + Intronic
1030053134 7:105557080-105557102 GAACTAGGATGACTATGAAATGG + Intronic
1030110614 7:106023528-106023550 GGAAGAGGAGGAGGAAGAAAGGG - Intronic
1030239477 7:107305321-107305343 GAAAAGGAATGAGCAAGAAATGG - Intronic
1030728587 7:112956767-112956789 GAAACAGACTGGGAAAGAAAAGG + Intergenic
1030904047 7:115160778-115160800 GAAATGGAATGAGAAAGAGAAGG - Intergenic
1030940184 7:115637175-115637197 GGAATAGAATGAGCAAGACAGGG + Intergenic
1031230335 7:119097199-119097221 GAAAGAGAAAGAGAAAGAGAAGG - Intergenic
1031583799 7:123508427-123508449 GAAATAAGTAGAGAAATAAAGGG - Intronic
1031706451 7:124985740-124985762 GAAAAAGGAGGAGAGAGAAAGGG + Intergenic
1032342485 7:131088103-131088125 GAAATAAGATGGGAAAGAACTGG - Intergenic
1032505839 7:132434122-132434144 GAAATAGGAACGGAAAGGAAGGG - Intronic
1032516705 7:132511686-132511708 AAAATAGGATTAGAAAGATTAGG + Intronic
1032523525 7:132563006-132563028 GAAAGAGGAAGAGAAAGAGGAGG - Intronic
1032523787 7:132564117-132564139 GAAGGAGGAGGAGAAAGAAGAGG - Intronic
1032767162 7:135007507-135007529 AAATTAGGAAGAGAAAGGAAAGG + Intronic
1032899520 7:136291180-136291202 CAAATACAATGTGAAAGAAATGG + Intergenic
1032974500 7:137206815-137206837 GAAAAAGAAAGAGAAAGAAAAGG - Intergenic
1033528381 7:142239775-142239797 GAAAGAGAAGGAGAGAGAAATGG + Intergenic
1033674270 7:143522313-143522335 GAAAAAGAATGAGAAGGAGAAGG - Intergenic
1033687046 7:143650489-143650511 GAAAAAGAATGAGAAGGAGAAGG - Intronic
1033697565 7:143807134-143807156 GAAAAAGAATGAGAAGGAGAAGG + Intergenic
1033922669 7:146413644-146413666 GAAACAGGAAGAGAGAGATAAGG - Intronic
1034041513 7:147882225-147882247 GAAAGAGCCTGAGGAAGAAATGG + Intronic
1034575701 7:151995061-151995083 GAATTATGAAGAGAAAGAAATGG - Intronic
1034886963 7:154805497-154805519 GAAATTTGATTAGAAAAAAAAGG + Intronic
1035017257 7:155777493-155777515 GAAGCAGAATGAGAAAGGAATGG + Exonic
1035358167 7:158291862-158291884 GAAAGAGGGAGAGAAAGAAGAGG + Intronic
1035856368 8:2980464-2980486 GAAGGAGGAGGAGAAAGAGAAGG - Intronic
1036164787 8:6422585-6422607 GAAATAGAGAGAGAGAGAAAGGG - Intronic
1036459792 8:8941883-8941905 GAAAAAGTCTGAGAAAGAATGGG - Intergenic
1036939890 8:13041231-13041253 GAAATATTATGAGAAACAAGGGG - Intergenic
1037010504 8:13836733-13836755 AAAAAAAGATAAGAAAGAAAGGG - Intergenic
1037023026 8:13997721-13997743 CAGAAAGGATGAGAAAGACAGGG - Intergenic
1037209833 8:16373351-16373373 GAAGGAGGATGGGTAAGAAAGGG - Intronic
1037598436 8:20373757-20373779 GAGAAAGGAGGAGGAAGAAAAGG + Intergenic
1037689789 8:21172152-21172174 GAAACAGCATGAGAGAGAGATGG - Intergenic
1037756668 8:21714610-21714632 GAAAGAGGAGGGGGAAGAAAGGG + Intronic
1037940094 8:22944780-22944802 GAAACAGGAATAGAAAGAATAGG - Intronic
1037991225 8:23322548-23322570 GAAAAAGGATGAGAGAAAACTGG - Intronic
1037997296 8:23362306-23362328 GGCCTGGGATGAGAAAGAAATGG + Intronic
1038029625 8:23626389-23626411 AATATAGGATAAGAAAGCAATGG + Intergenic
1038148246 8:24918012-24918034 GAAAAAGGAAGAGAAACCAAAGG + Exonic
1038363044 8:26902042-26902064 GAAATAAGAAGAGAAAGTCAGGG + Intergenic
1038398588 8:27265904-27265926 GAAAGAGGGAGAGAGAGAAAGGG - Intergenic
1038398598 8:27265986-27266008 GAAAGAGGGAGAGAGAGAAACGG - Intergenic
1038398611 8:27266094-27266116 GAAGGAGAAAGAGAAAGAAATGG - Intergenic
1038483648 8:27918814-27918836 GGAAAAGGATAAGGAAGAAAGGG + Intronic
1038759665 8:30374902-30374924 GGAGAAGGATCAGAAAGAAAAGG - Intergenic
1038811152 8:30845938-30845960 AAAGTAGGAGAAGAAAGAAAGGG - Exonic
1038851702 8:31284939-31284961 GAAATGTGATTAGACAGAAAGGG + Intergenic
1039054909 8:33528292-33528314 GAAAAAAGAAAAGAAAGAAAAGG - Intergenic
1039201740 8:35102521-35102543 GGAGTAGGAAGAGAAAGAAAGGG + Intergenic
1039908806 8:41807999-41808021 GAAAGAGGAAGAGGAAGAGAAGG + Intronic
1039986509 8:42452329-42452351 GAGATAGGAGGAGGAAGAAATGG + Intronic
1040603666 8:48909430-48909452 TAAATAAGAGGAGAAAGAGAAGG + Intergenic
1040631654 8:49220349-49220371 GAAATAGCATGAAAAAAATATGG + Intergenic
1040676977 8:49762203-49762225 GAAATGAGAGGAGAAGGAAAAGG - Intergenic
1040833481 8:51705530-51705552 GAAAGAGTAGGAGAAAGAGAAGG + Intronic
1041192746 8:55369535-55369557 GAAAGAGAGAGAGAAAGAAAGGG + Intronic
1041289683 8:56296942-56296964 GAGACAGGAGGAGAAAGAAAGGG - Intergenic
1041317521 8:56579782-56579804 GAATGAGGAGGAGAAAGAAGGGG + Intergenic
1041401347 8:57448697-57448719 GAAAGAGGAGGAGAAAGAGGAGG - Intergenic
1041411751 8:57563861-57563883 AAAAGAGGATGAGAAGGAAGAGG - Intergenic
1041899910 8:62970649-62970671 GGAAGAGAAAGAGAAAGAAAGGG + Intronic
1041961526 8:63622716-63622738 GAAAAAGAAGAAGAAAGAAAAGG - Intergenic
1042463344 8:69096911-69096933 GCAGTAGGAAGAGAAAGAAATGG + Intergenic
1042488075 8:69368507-69368529 GAAATATGATTGGAAAAAAAAGG - Intergenic
1042934934 8:74048854-74048876 GAAAGAAAAGGAGAAAGAAAAGG + Intergenic
1042938158 8:74081248-74081270 AAAAAAGAAGGAGAAAGAAAGGG - Intergenic
1043137487 8:76546727-76546749 GGAATAGGATGAGAACCAAAAGG - Intergenic
1043367001 8:79544079-79544101 GAAATAGGAAGAGAGAGAGGGGG + Intergenic
1043374823 8:79636558-79636580 TAAATAACAAGAGAAAGAAAGGG - Intronic
1043493996 8:80780200-80780222 GAAGAAGAAAGAGAAAGAAATGG + Intronic
1043615190 8:82116320-82116342 GAAGGAGGAAGAGAGAGAAAGGG - Intergenic
1043651339 8:82596539-82596561 GAAAAAGGAAAAGAAAAAAAGGG - Intergenic
1043693426 8:83186968-83186990 GAAGAAGGAGGAGAAAGAAAAGG - Intergenic
1044020772 8:87103219-87103241 TGAGTAGGATGGGAAAGAAATGG + Intronic
1044034762 8:87287020-87287042 GAAAAAGGAAAAGAAAAAAATGG - Intronic
1044130385 8:88516267-88516289 GAAATAAATTGAGATAGAAAGGG - Intergenic
1044164775 8:88968051-88968073 GAAACAGGAAGGAAAAGAAAGGG - Intergenic
1044228909 8:89751497-89751519 AAAAAAGGAGGAGAAGGAAACGG + Intergenic
1044401885 8:91782353-91782375 GAAAGAGAGAGAGAAAGAAAGGG - Intergenic
1044413565 8:91911062-91911084 GAAATGAGATGGGAAAGAACTGG + Intergenic
1044422939 8:92019458-92019480 GCAATAGGAGGAAAAAGAAGAGG + Intronic
1044539971 8:93397882-93397904 GAAAGAGAAAGAGAGAGAAAGGG - Intergenic
1044581385 8:93829704-93829726 GAAAAAGAGAGAGAAAGAAAGGG - Intergenic
1044735679 8:95275705-95275727 AAAAAAGAAAGAGAAAGAAAGGG - Intergenic
1044772379 8:95650169-95650191 GAAAAAGGAAGAGATACAAAAGG - Intergenic
1044887903 8:96799117-96799139 GAAAGCAGATGAGAAAGAGAAGG + Intronic
1045035728 8:98175020-98175042 GAGATTGGATGAGAAAGACCTGG + Intergenic
1045204740 8:100026565-100026587 GAAATAGAAGGAGAAACAACAGG + Intronic
1045670845 8:104551816-104551838 GAAAGAGAGTAAGAAAGAAAAGG - Intronic
1045851503 8:106704357-106704379 GAAAAAGAAAAAGAAAGAAAAGG - Intronic
1045872370 8:106941065-106941087 GGAATAGGATGGGATAGAGAGGG - Intergenic
1045911774 8:107418367-107418389 GAAAAAAGTTGAGAAAAAAATGG + Intronic
1045975631 8:108127965-108127987 ATAATTGGATGAAAAAGAAAAGG + Intergenic
1046059869 8:109125668-109125690 AAAATAAGATGAGTAAGGAAAGG + Intergenic
1046233614 8:111391648-111391670 GAAATAAGAGGGGAAACAAATGG + Intergenic
1046283817 8:112069737-112069759 GAGATAGGTTTAAAAAGAAAAGG - Intergenic
1046663773 8:116977115-116977137 GAAAAAGAAAAAGAAAGAAAAGG - Intronic
1046826319 8:118695748-118695770 TCAAGAGGAAGAGAAAGAAAAGG + Intergenic
1046827523 8:118707522-118707544 GAAATAGGCTGAGAAAAGAGTGG + Intergenic
1046847966 8:118939901-118939923 GAGCTAGGATGAAAAAGCAAAGG + Intronic
1047161611 8:122386780-122386802 TAAATAGGATTGGGAAGAAATGG - Intergenic
1047425959 8:124747380-124747402 GAAAGAGGGAAAGAAAGAAAAGG - Intergenic
1047781387 8:128114300-128114322 TAAAAAGGGTGAGAGAGAAAGGG - Intergenic
1047931243 8:129730018-129730040 GAAAAAGGATGAGAAGGAAAAGG + Intergenic
1048012116 8:130466229-130466251 GAAAAAGGAGGAGGAAGAGAAGG - Intergenic
1048161143 8:132023207-132023229 GAAATAGGAAAGGAAAGGAAAGG - Intergenic
1048261514 8:132949383-132949405 CCAATAGGATGAGGCAGAAATGG - Intronic
1048289483 8:133169655-133169677 TAAATAGAATGAGAAACACATGG + Intergenic
1048450364 8:134528072-134528094 GAAAGAGGAGGAGAAGGAAGAGG - Intronic
1048605616 8:135965254-135965276 GAAAAAGGATGAAAAAAAAGGGG + Intergenic
1048840349 8:138560258-138560280 GATAGAGGATGAGAATGAGAAGG + Intergenic
1048945734 8:139445490-139445512 GATATCTGATGTGAAAGAAAAGG + Intergenic
1049014911 8:139913521-139913543 CAAACAGCATGAGCAAGAAATGG - Intronic
1049400024 8:142421204-142421226 GAAGGAGGAGGAGAAAGAGAAGG + Intergenic
1049517077 8:143065724-143065746 GAGAAAGAAAGAGAAAGAAAGGG - Intergenic
1050219165 9:3366656-3366678 GAAAGAGAAAGAGAAAGAAAAGG - Intronic
1050241657 9:3642538-3642560 GAAATAACATGAGTAAGAAAGGG - Intergenic
1050512477 9:6410857-6410879 GAACTAGAATGATTAAGAAAAGG - Intergenic
1050715999 9:8526289-8526311 GAAAAAGGAAGAAGAAGAAAAGG + Intronic
1051007012 9:12357468-12357490 GAAACAGGATTAGGAAGAATGGG - Intergenic
1051336775 9:16072740-16072762 CGAATAGGACGAGAAGGAAAGGG - Intergenic
1051576478 9:18621989-18622011 GAAAGAGAATGAGAGAGAATAGG - Intronic
1051632991 9:19157287-19157309 GAAGGAGAAGGAGAAAGAAAAGG - Intergenic
1051864888 9:21668675-21668697 GAAAAAGGAAGTGAAAGAAATGG + Intergenic
1052020926 9:23524496-23524518 GAAGTAGGAGGAGAAAGACCAGG - Intergenic
1052081937 9:24216927-24216949 GAAATAGAGTGTGTAAGAAAAGG + Intergenic
1052089131 9:24305696-24305718 GAAAGAGAATAAGAGAGAAAGGG + Intergenic
1052215232 9:25959314-25959336 TAAATTGAATTAGAAAGAAAGGG + Intergenic
1052216819 9:25976075-25976097 GAAGGAGGATGAGAACAAAAAGG - Intergenic
1052265760 9:26571160-26571182 AAAATAGGGAGAAAAAGAAAAGG + Intergenic
1052631656 9:31048853-31048875 AAAATAGGCTTAGCAAGAAAGGG + Intergenic
1052792623 9:32889892-32889914 GGAAATAGATGAGAAAGAAAAGG + Intergenic
1052925345 9:34010938-34010960 GAAAAAGTATGAAAAAGTAATGG + Intronic
1052981013 9:34449432-34449454 GAAATATTATGAGAAAAACAAGG + Intronic
1053636889 9:40017105-40017127 GAATTTGAATCAGAAAGAAAAGG - Intergenic
1053688856 9:40569868-40569890 GCAATCAGATGAGAAAAAAAAGG + Intergenic
1053769139 9:41447797-41447819 GAATTTGAATCAGAAAGAAAAGG + Intergenic
1053825957 9:42024803-42024825 GAAACTGGATGAGAAATAATTGG - Intronic
1054275181 9:63061206-63061228 GCAATCAGATGAGAAAAAAAAGG - Intergenic
1054300096 9:63370785-63370807 GCAATCAGATGAGAAAAAAAAGG + Intergenic
1054317718 9:63613898-63613920 GAATTTGAATCAGAAAGAAAAGG - Intergenic
1054399650 9:64703734-64703756 GCAATCAGATGAGAAAAAAAAGG + Intergenic
1054433233 9:65187995-65188017 GCAATCAGATGAGAAAAAAAAGG + Intergenic
1054497150 9:65833674-65833696 GCAATCAGATGAGAAAAAAAAGG - Intergenic
1054604606 9:67162593-67162615 GAAACTGGATGAGAAATAATTGG + Intergenic
1054986184 9:71264179-71264201 GAAGTAGGAGAAGAATGAAAAGG + Intronic
1054991400 9:71331633-71331655 GAAAAAGGAGGAGGAAGAAGAGG + Intronic
1054991423 9:71331732-71331754 GAAAAAGGAGGAGGAGGAAAAGG + Intronic
1055057947 9:72040663-72040685 GAAATATGATTAGACAAAAATGG - Intergenic
1055166322 9:73199713-73199735 GAAAGAGGAGGAGGAAGAGAAGG + Intergenic
1055312092 9:74993312-74993334 GAAAACAGAAGAGAAAGAAAGGG + Intronic
1056002208 9:82229021-82229043 GAAAGAGAAGGAAAAAGAAAAGG + Intergenic
1056035198 9:82597345-82597367 GACATATGATGAGAATGAATAGG + Intergenic
1056146006 9:83729954-83729976 GAAAAAGGAAGAGAAAGAGGAGG + Intergenic
1056236989 9:84604467-84604489 GAAAAAGGAAGAAAAAGAAGAGG - Intergenic
1056290387 9:85137199-85137221 AAAAAAGGAAGAGAAAGAAAAGG + Intergenic
1056381775 9:86062708-86062730 GAAAAAGGAGGAGAAGCAAACGG + Intronic
1056534175 9:87513513-87513535 GAAATAAGACATGAAAGAAATGG + Intronic
1056710701 9:88990509-88990531 GAAAAAGGAGGAGGAGGAAAAGG - Intergenic
1056712727 9:89004042-89004064 GAAATAGCATGAGAAAACACAGG + Exonic
1056774020 9:89498302-89498324 GAAAGAGGAGGAAAAAGAGAAGG - Intergenic
1056951624 9:91044723-91044745 AAGGTAGGCTGAGAAAGAAAAGG - Intergenic
1057537798 9:95931894-95931916 GAAAAAGGAAGAAAAAAAAAAGG - Intronic
1058128174 9:101220579-101220601 GAAACATGAGGATAAAGAAAGGG - Intronic
1058164416 9:101604145-101604167 GAGAAAGGAAGAGAAAGAAAAGG + Intronic
1058170588 9:101676303-101676325 TAAATAGGGGGAAAAAGAAAAGG - Intronic
1058343415 9:103926679-103926701 GAAAGAGGAAGAGAAGGGAAAGG + Intergenic
1058452824 9:105113072-105113094 GAAAAAGAAGGAGAAAGAGAAGG + Intergenic
1058526131 9:105859658-105859680 GAAAGAGAAAGAGAAAGAAAGGG + Intergenic
1058696244 9:107561590-107561612 AAAAAAAGATGACAAAGAAAAGG - Intergenic
1058792392 9:108463010-108463032 GTAATACAATGACAAAGAAATGG + Intergenic
1058801387 9:108547615-108547637 GACAAAGGAAGAGAAAGAAGAGG + Intergenic
1058896470 9:109404963-109404985 GAAAAAACCTGAGAAAGAAAGGG - Intronic
1058955784 9:109946739-109946761 GAAAGAGGAGGAAAAAAAAAAGG + Intronic
1059003646 9:110377437-110377459 GAAATAGTATGAGATATAAAGGG - Intronic
1059009034 9:110436510-110436532 GAGAGAGAAAGAGAAAGAAAAGG + Intronic
1059037068 9:110765925-110765947 GAAATATGATTAGACACAAAGGG + Intronic
1059174868 9:112160556-112160578 TAAAGAAGATGAGAAAGAGATGG + Intronic
1059615779 9:115949453-115949475 GAAAGAGAGAGAGAAAGAAAAGG + Intergenic
1059702075 9:116784947-116784969 AAAATAAGAGGAGCAAGAAATGG + Intronic
1059804436 9:117783427-117783449 GAAATAAAGAGAGAAAGAAAAGG + Intergenic
1059901186 9:118927935-118927957 GAAACAGGATAAAACAGAAAAGG - Intergenic
1059939166 9:119340906-119340928 GCAAAAGGATAAGAATGAAAAGG + Intronic
1060392261 9:123287766-123287788 GAACTAGACTCAGAAAGAAAAGG - Intergenic
1062093899 9:134693078-134693100 AAAAAAGGAAAAGAAAGAAATGG + Intronic
1062247524 9:135576834-135576856 GAAAGAGAGAGAGAAAGAAATGG - Intergenic
1202784750 9_KI270719v1_random:695-717 GAATTTGAATCAGAAAGAAAAGG - Intergenic
1185523711 X:760994-761016 GGAAGAGGAGGAGAAAGAAGAGG - Intergenic
1185523732 X:761092-761114 GGAAGAGGAGGAGAAAGAAGAGG - Intergenic
1185556777 X:1027578-1027600 GAGAAAGAAAGAGAAAGAAAAGG - Intergenic
1185692794 X:2170178-2170200 GAAATAGAAAGAAAAAGACATGG + Intergenic
1185701156 X:2231411-2231433 GAAAAAGGAAGAGGAAGCAAAGG - Intronic
1185827855 X:3270075-3270097 GAAGAAGGATGAGGAAGAAGAGG - Intergenic
1185948941 X:4408682-4408704 GAAATAGGATTGGATAAAAATGG + Intergenic
1186047123 X:5548652-5548674 GAAGGAGGAGGAGAAGGAAAAGG - Intergenic
1186058818 X:5681486-5681508 GAAAGAGGAGGAGATGGAAAAGG + Intergenic
1186094980 X:6090958-6090980 GAGAGAGGAAGAAAAAGAAAAGG + Intronic
1186213387 X:7273629-7273651 GAAATAGGATTGGACAAAAAGGG - Intronic
1186228718 X:7429479-7429501 AAAAGAGGAGAAGAAAGAAAAGG + Intergenic
1186231231 X:7456701-7456723 GGAAGAGAAGGAGAAAGAAAGGG - Intergenic
1186382134 X:9071915-9071937 GAGATAGGTTGAGAAGAAAATGG - Intronic
1186561161 X:10614807-10614829 GAAACAGAAGGAGAAAGAATTGG - Intronic
1186697858 X:12056319-12056341 GAAATAGGATTGGACAAAAAGGG + Intergenic
1186783590 X:12938493-12938515 AAAATAGGAGGAAAAAGAAGAGG - Intergenic
1186790475 X:12992537-12992559 GAAATTGGATGAGGAATAAATGG + Intergenic
1186952051 X:14637332-14637354 GAGGTGGAATGAGAAAGAAAAGG + Intronic
1187389422 X:18876038-18876060 GAAAAGGGAAGAGAAGGAAAAGG - Intergenic
1187549813 X:20290710-20290732 AAAATAAGATGAGAAGCAAAAGG - Intergenic
1187666562 X:21617838-21617860 GAAATATGAGAAGAAAGAAATGG + Intronic
1187696151 X:21923117-21923139 GAAAGAGGAAAGGAAAGAAAAGG + Intergenic
1188011451 X:25060598-25060620 GAAAGAAGAGGAGAAAGAAAAGG - Intergenic
1188019622 X:25143251-25143273 GAAAGAAGATGATAAATAAAGGG - Intergenic
1188107547 X:26162292-26162314 ATAATATGAAGAGAAAGAAAAGG + Intergenic
1188110939 X:26195525-26195547 ATAATATGAAGAGAAAGAAAAGG + Exonic
1188296259 X:28453227-28453249 GAAATACCATGAGAAACAACCGG - Intergenic
1188379258 X:29471207-29471229 CAAATAGGAGGGAAAAGAAAGGG + Intronic
1188436819 X:30170091-30170113 AAAATATGGTAAGAAAGAAAGGG - Intergenic
1188730891 X:33645433-33645455 GAAAAAGGAGGAGGAAGAAGAGG + Intergenic
1188787419 X:34365419-34365441 AAGATAGAATCAGAAAGAAAGGG - Intergenic
1188824125 X:34809230-34809252 GAAATAGACTGCCAAAGAAATGG + Intergenic
1188882125 X:35501813-35501835 GAAAGGGGAGGAGGAAGAAAAGG - Intergenic
1188962212 X:36506611-36506633 GAAATAGTATGAAAAATGAATGG - Intergenic
1188995558 X:36880882-36880904 GAAATAGACTGCCAAAGAAATGG - Intergenic
1189138571 X:38576966-38576988 GAAATAGGAAAAGCAAGAAGTGG + Intronic
1189212302 X:39294062-39294084 GGAATTTGAGGAGAAAGAAATGG + Intergenic
1189306390 X:39989930-39989952 GGAAAAGGAAGGGAAAGAAAAGG - Intergenic
1189726815 X:43975698-43975720 GAAACAGGACCAGAAATAAAAGG - Intergenic
1189795868 X:44645453-44645475 GAAAGAAGGAGAGAAAGAAAGGG + Intergenic
1189854795 X:45213680-45213702 GATATAAGATGAGAGACAAAAGG - Intergenic
1189922006 X:45911535-45911557 ATAATAGGAAAAGAAAGAAATGG - Intergenic
1190021110 X:46876676-46876698 GTACAAGAATGAGAAAGAAAAGG - Intronic
1190179190 X:48177216-48177238 GAAAAAAGAAAAGAAAGAAAGGG + Intergenic
1190636166 X:52436045-52436067 GAAGTAGGAAGAGCATGAAAGGG + Intergenic
1190643577 X:52503951-52503973 GAAGTAGGATGAGTGCGAAAGGG + Intergenic
1190739590 X:53280401-53280423 GAAAGAGGAAGACAGAGAAAGGG + Intronic
1191684153 X:63871536-63871558 CAAAGAGGATCAGAGAGAAATGG - Intergenic
1191937713 X:66442949-66442971 AAGAAAGGATGAGAAGGAAAAGG - Intergenic
1192328891 X:70158326-70158348 GGAATAGAAAAAGAAAGAAAAGG + Intronic
1192331844 X:70182030-70182052 GAAAGAAGGTGAGAAAGAAAAGG - Intronic
1192399223 X:70817754-70817776 GAAAAAGGAAAAGAAAGGAAAGG + Intronic
1192449405 X:71234309-71234331 GAAAGAGAAAGAAAAAGAAATGG - Intergenic
1192548743 X:72036565-72036587 GAAATAAAATGAGACTGAAAAGG - Intergenic
1193175363 X:78386126-78386148 GTAATTTAATGAGAAAGAAAAGG + Intergenic
1193218981 X:78899802-78899824 GTGTTAGGAGGAGAAAGAAAGGG + Intergenic
1193626197 X:83823548-83823570 GCAATAGAAAGAGAAATAAAGGG + Intergenic
1193812965 X:86073451-86073473 TAAAGATGATGAGAAAGAATGGG - Intergenic
1194173646 X:90620413-90620435 TAACTAATATGAGAAAGAAAAGG + Intergenic
1194279558 X:91932337-91932359 GAGAAATGGTGAGAAAGAAAGGG + Intronic
1194383973 X:93230507-93230529 AGAATAGGATGACAGAGAAAAGG + Intergenic
1194431393 X:93811284-93811306 GAAATAGAAGGAGAAAGGGAGGG - Intergenic
1194508127 X:94758680-94758702 GAAAGAGGAATAGAAATAAATGG + Intergenic
1194530457 X:95042108-95042130 TAAATATGATCAGAAACAAAAGG + Intergenic
1194541818 X:95182467-95182489 GAAGTAGAATGGGAAATAAATGG + Intergenic
1194580898 X:95669388-95669410 GAAATAGTTTCAGAAAAAAATGG - Intergenic
1194697302 X:97069278-97069300 GAAATATGAGGAGAATTAAAAGG - Intronic
1194715499 X:97282997-97283019 GACATAGGTTGAGAAATCAAGGG + Intronic
1194869646 X:99113345-99113367 GAGAGAGGAAGAGAAAGAAAAGG - Intergenic
1194872645 X:99152462-99152484 GAAATAGCATAAGAAATACATGG - Intergenic
1195018613 X:100802737-100802759 AAAAGAGAATGAGAAAGAAAAGG + Intergenic
1195155883 X:102124752-102124774 ATAATAGGACGGGAAAGAAAAGG + Intergenic
1195248187 X:103015726-103015748 GCAGGAGGATGAGAAAGAGAAGG - Intergenic
1195272002 X:103241629-103241651 GAAAGAGGAGGAGAAAGAGGAGG - Intergenic
1195307623 X:103600883-103600905 TAAATGGGAAGAGACAGAAAGGG - Intergenic
1195498378 X:105564840-105564862 GAAAAAGGAAGGGAATGAAAAGG - Intronic
1195762874 X:108265777-108265799 GAAGTTGGAAGAGAAAGACAGGG + Intronic
1195793759 X:108621032-108621054 GAGAAAGAAAGAGAAAGAAAGGG - Intronic
1195814582 X:108870830-108870852 GAAAGAAGGTGAGAGAGAAAAGG - Intergenic
1196008333 X:110858903-110858925 ACAATACGATGAGAAAGACATGG + Intergenic
1196154195 X:112408560-112408582 GAAGTAGGTAGAGAAAGAGATGG + Intergenic
1196233293 X:113250924-113250946 GTAATTCAATGAGAAAGAAAAGG - Intergenic
1196457318 X:115899675-115899697 GAAAAAGGAAGAGACAGAGAAGG - Intergenic
1196551291 X:117028875-117028897 GGTATAGAATGAGGAAGAAAAGG - Intergenic
1196565418 X:117198608-117198630 GAAATAATAGGAGAACGAAAAGG + Intergenic
1196580310 X:117371506-117371528 GAAATAAGAACAGAAAGAACAGG - Intergenic
1196711848 X:118770928-118770950 GGAATAGGATGAGAGGCAAAGGG - Intronic
1196894420 X:120320924-120320946 TAAGTAGGATGTCAAAGAAAAGG - Intergenic
1197134535 X:123045665-123045687 GAAGGAGGAAGAGAAAGAGAAGG - Intergenic
1197164011 X:123356352-123356374 CAAATAAGAGGAGAAGGAAAGGG - Intronic
1197202918 X:123764297-123764319 AAAAAAGGAAAAGAAAGAAATGG + Intergenic
1197232786 X:124023810-124023832 GAAATAGGATAATGAATAAAAGG + Intronic
1197247120 X:124177682-124177704 GGAAGAGGAGGAGAAAGAGAAGG - Intronic
1197276831 X:124489219-124489241 GAGTTAGGAGGAGAAAGAAATGG + Intronic
1197522827 X:127520663-127520685 GAACTAGGTTGAGGATGAAATGG + Intergenic
1197546810 X:127835810-127835832 GAGAAAGGAGGAGACAGAAAAGG + Intergenic
1197594961 X:128453614-128453636 AAGAAAGGATGAGAAAGAATGGG - Intergenic
1197751004 X:129963489-129963511 GAAGGAGGAAGAAAAAGAAAAGG + Intergenic
1197836679 X:130701960-130701982 GAAATGGGTGGAGAAAAAAAAGG - Intronic
1198366743 X:135947740-135947762 GAAAAACGAGGACAAAGAAAAGG + Intergenic
1198479997 X:137032514-137032536 GAAATAGACTGAGAGAGAAATGG - Intergenic
1198662196 X:138981789-138981811 GAAATAAGATGTGAGAAAAAGGG - Intronic
1198738336 X:139812413-139812435 GAAAGAGGAAATGAAAGAAAGGG + Intronic
1198817869 X:140612475-140612497 GAAATTTAATCAGAAAGAAAAGG - Intergenic
1199215632 X:145257343-145257365 GAAATAGGATTGGACAAAAAGGG - Intergenic
1199284555 X:146041830-146041852 GGAAGAGGAGGAGAAAGAAAAGG + Intergenic
1199327671 X:146519062-146519084 GAAAGAAAATTAGAAAGAAAAGG - Intergenic
1199526755 X:148801381-148801403 GAAATTGGAAGAGAAAAGAAAGG - Intronic
1199598880 X:149528740-149528762 GAAAGAGGACGGGAGAGAAAGGG - Intronic
1199650790 X:149944820-149944842 GAAATAGGAGGAGGGAGGAAAGG + Intergenic
1200287907 X:154841674-154841696 GCAATAAGATGAGAAAAAGAAGG - Intronic
1200369454 X:155707673-155707695 GAAAGAGTATTAGAAATAAAGGG - Intergenic
1200519866 Y:4198096-4198118 TAACTAATATGAGAAAGAAAAGG + Intergenic
1200524884 Y:4261373-4261395 GAAAGAGAAAGAGAAGGAAAAGG - Intergenic
1200597034 Y:5155828-5155850 GAGAAATGGTGAGAAAGAAAGGG + Intronic
1200746131 Y:6905426-6905448 GAAAAAGAAAGAGAAAGAAAGGG - Intergenic
1201228455 Y:11840482-11840504 GGAATAGGATGGTAAAGGAATGG - Intergenic
1201257637 Y:12124670-12124692 GGAATAGGAAGAGAAAGAAATGG + Intergenic
1201406305 Y:13653570-13653592 GAAATAGGTTGAGACAAAAGTGG - Intergenic
1201617863 Y:15921749-15921771 GAAATAGGATTGGATAAAAAGGG + Intergenic
1201736036 Y:17262625-17262647 GAAATAGGATTGGACAAAAAGGG + Intergenic
1202166186 Y:21991456-21991478 AAAATGTAATGAGAAAGAAAAGG - Intergenic
1202225172 Y:22594917-22594939 AAAATGTAATGAGAAAGAAAAGG + Intergenic
1202317942 Y:23600744-23600766 AAAATGTAATGAGAAAGAAAAGG - Intergenic
1202374432 Y:24220732-24220754 GAAAAAGAAAAAGAAAGAAAGGG + Intergenic
1202496348 Y:25449388-25449410 GAAAAAGAAAAAGAAAGAAAGGG - Intergenic
1202552824 Y:26069314-26069336 AAAATGTAATGAGAAAGAAAAGG + Intergenic