ID: 907834082

View in Genome Browser
Species Human (GRCh38)
Location 1:58092818-58092840
Sequence CTGAGGAATGGCACGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907834082 Original CRISPR CTGAGGAATGGCACGGTGGA TGG (reversed) Intronic
900398166 1:2461814-2461836 TTGGGGAATGGCACCATGGAAGG + Intronic
903745548 1:25584420-25584442 GAGAGAAATGGCAGGGTGGAAGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905131304 1:35760580-35760602 GTGAGGAATGTCAGGTTGGAGGG - Exonic
905348606 1:37328688-37328710 CTGAGGAATGGCACCTGGGAGGG - Intergenic
906856283 1:49308727-49308749 ATGAGAAAAGGCAGGGTGGAAGG + Intronic
907834082 1:58092818-58092840 CTGAGGAATGGCACGGTGGATGG - Intronic
910880665 1:91919791-91919813 CTGAGGAAGGGAAAGGTGGTTGG - Intergenic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
915446053 1:155975665-155975687 CTGAGGAATGGAGAGGTGGCTGG - Intronic
915511816 1:156390799-156390821 GTGAGGAATTGCAGGGAGGAGGG - Intergenic
920078413 1:203353936-203353958 CAGAGGATTGGCAAAGTGGAGGG + Intergenic
1063617671 10:7615688-7615710 CTGAGGACTGGCCCTGTCGATGG + Intronic
1063685071 10:8229141-8229163 GTGTGGAAAGGCACTGTGGAAGG + Intergenic
1065536093 10:26716181-26716203 CTAAGGAATGGCAGAGTGCAGGG - Intronic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1069075521 10:64034740-64034762 CTCAGGGATGGCAGTGTGGATGG + Intergenic
1070027042 10:72641593-72641615 CAGAGGAATGGCACTTTTGAAGG - Intergenic
1070503145 10:77090292-77090314 TTGGGGAATGGCACTGGGGATGG - Intronic
1074570470 10:114619591-114619613 CTGAGGGATGGGACGATGCATGG + Intronic
1074708595 10:116158338-116158360 ATGAGGGCTGGCACTGTGGATGG + Intronic
1075052702 10:119194639-119194661 CTCAGCAATGGCTGGGTGGAGGG + Intergenic
1075380845 10:122017370-122017392 CTGAGGACTGGCAGGGAGGGAGG - Intronic
1075536298 10:123275000-123275022 CGGATGAATGGCCCGGCGGAGGG + Intergenic
1076569925 10:131425916-131425938 CTGAGGAATGGCACCGAAAATGG + Intergenic
1077498475 11:2898089-2898111 CTGAGAAATGGGACTGTGGCTGG - Intronic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1083872423 11:65497452-65497474 CTGGGGAATGGCATGGGGGCGGG - Intergenic
1084153628 11:67302536-67302558 CTGTGGAGAGGCACTGTGGATGG + Intergenic
1084773462 11:71359241-71359263 ATGAGGGATGGATCGGTGGATGG - Intergenic
1085642449 11:78200867-78200889 CTGTGGTATGGCCCGCTGGAAGG - Intronic
1089051526 11:115549802-115549824 GTGAGGAATGGCACGGGGGAAGG + Intergenic
1090722496 11:129489340-129489362 CTGAGGAAGGGCGCTGTGGAAGG + Intergenic
1090899336 11:131013559-131013581 CAGAGGAATGACATGGTGGTGGG + Intergenic
1093724673 12:22490138-22490160 CTGCAGGATGGCACCGTGGAAGG - Exonic
1093964645 12:25311747-25311769 TTGAGGGATGACACGGTGGCTGG - Intergenic
1096909282 12:54966023-54966045 CTGAAGTTTGGCAGGGTGGAAGG - Intronic
1097237233 12:57548930-57548952 AAGAGGAAGGGCAGGGTGGATGG - Intergenic
1097548904 12:61041656-61041678 CTGTGGAATGGAAAGGTAGAGGG - Intergenic
1097966550 12:65587679-65587701 TTGAGAAATGGCATGGTGAAGGG + Intergenic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1099650122 12:85415906-85415928 CTGAGGAAAATCAAGGTGGAAGG + Intergenic
1100190394 12:92184835-92184857 CTGAGGGTTGGCAGAGTGGAGGG - Intergenic
1101202870 12:102455053-102455075 CCCAGGAATGGCACGGTGGGTGG - Intronic
1102028861 12:109728571-109728593 CTGAGCAAAGGCACAGAGGAAGG - Intronic
1103245794 12:119456102-119456124 CAAAGGAATGGCAGGGTGAATGG + Intronic
1104092174 12:125526336-125526358 ATGAGGGATGGCACAGTGGATGG - Intronic
1104724336 12:131066734-131066756 CTGAGGAGTGGCCACGTGGATGG + Intronic
1104873672 12:132018051-132018073 CTGTGTATTGGCACGGAGGAGGG + Intronic
1110159612 13:72359800-72359822 CTTAGGGAGGTCACGGTGGATGG - Intergenic
1110878835 13:80544768-80544790 CTGAGGAATGGTACTGGGAATGG + Intergenic
1111127840 13:83935342-83935364 CTGAAGAAGGGCATGGAGGAAGG + Intergenic
1111476614 13:88757856-88757878 CTGAGGGATGTCATGGGGGAAGG - Intergenic
1112421913 13:99260064-99260086 GTGAGGAATGCCACAGTGGGTGG - Intronic
1114427204 14:22633919-22633941 CTGAGGAATGACACAGTGCAGGG - Exonic
1119536716 14:75408921-75408943 TTGACGAATGTCACGGTGGGTGG + Intergenic
1120671538 14:87368091-87368113 CTGAGGCATGGCACCAAGGATGG + Intergenic
1120794020 14:88611336-88611358 CTTTGGAAGGCCACGGTGGAAGG - Intronic
1121511265 14:94514955-94514977 CTGAGGAAACCCACGGTGGCCGG + Intronic
1122994925 14:105257882-105257904 CTGGGGAAAGGCAGGGTGGGTGG + Intronic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1127352024 15:58162622-58162644 CTGAGAGATGGCATGGTGCAGGG + Intronic
1128671231 15:69576102-69576124 CTGAGGGTTGGCACTGTGGCTGG - Intergenic
1129450851 15:75650415-75650437 GTGAGAAATGGCACTGTTGAGGG - Exonic
1131698418 15:94905522-94905544 CTGTGGAAAGGATCGGTGGACGG + Intergenic
1136056320 16:27692543-27692565 CTGAGGAGTGGCAAGGGGGCTGG - Intronic
1140671715 16:77286115-77286137 TTGAGGAATGGCACGATGCTTGG - Intronic
1141470100 16:84232266-84232288 CTGACGCATGGCACAGTGCATGG + Intronic
1141909680 16:87050196-87050218 CTTAGGAAGGGGTCGGTGGACGG - Intergenic
1143320174 17:6063248-6063270 CTAAGGAAAGGCAGGGAGGAGGG - Intronic
1144050797 17:11495706-11495728 CAGAGGGATGGCAGGGTGGCCGG - Intronic
1144438459 17:15261480-15261502 CTGGGGAAGCGCGCGGTGGACGG - Intronic
1145032562 17:19516058-19516080 CTTAGGAAGGCCAAGGTGGAGGG + Intronic
1146468878 17:33108705-33108727 CTGAAGAAAGGTACGATGGAGGG + Intronic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1147293419 17:39461775-39461797 CTGAGGACTGGCTCGGCGGAGGG + Intronic
1148547196 17:48527517-48527539 CCGAGGAGTGGCTGGGTGGAAGG + Intergenic
1148998053 17:51729174-51729196 TTGAGGAATAGCAAGGTGTAGGG - Intronic
1149272561 17:54996221-54996243 CAGAGAAGTGGCAGGGTGGATGG + Intronic
1152905082 17:82965548-82965570 CGGAGGCATGGCAAGGCGGAGGG + Intronic
1153512516 18:5870873-5870895 TTGAGGAATGGCACAGGAGATGG - Intergenic
1153679657 18:7488579-7488601 CTGAGGAATGGGAGGGCGCATGG - Intergenic
1154027000 18:10717338-10717360 TTGAGGACTGGCACGGTGGAGGG + Intronic
1155493266 18:26420017-26420039 CTGAGGTCTGGCACGGTGCCTGG + Intergenic
1156123155 18:33869932-33869954 ATGAAGAAAGGCAGGGTGGATGG + Intronic
1160833480 19:1113812-1113834 CTGAGGGACGGCAGGGTGGCGGG + Intronic
1161214149 19:3084973-3084995 CTGAGGACAGGCAGGGTGCAAGG - Intergenic
1162034265 19:7930952-7930974 CTGAGGAATGGAAAGGGGCAGGG + Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1165127838 19:33613254-33613276 CTGAGGACAGGGACGGGGGACGG + Intergenic
1168095049 19:54109795-54109817 CTGAGGGAGGGCCGGGTGGAGGG - Intronic
1168095157 19:54110245-54110267 CGGAGGGATGGGAAGGTGGAAGG - Intronic
925377776 2:3400512-3400534 CTGAGGAAAGGCACCTGGGAAGG - Intronic
925574211 2:5343824-5343846 CTGAGGAACGGCCAGGTGGGTGG - Intergenic
928083862 2:28333475-28333497 CACAGGCATGGCATGGTGGAGGG - Intronic
931010181 2:57902822-57902844 TTGAGGAATGGAATGGTGAAGGG + Intergenic
934515440 2:94983432-94983454 CCGAGGGATGCCACGGTGGCGGG + Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
935737858 2:106120499-106120521 GTGAGAAATGGCACCGAGGAAGG - Intronic
937289348 2:120772767-120772789 CTGAAGAATGCCACGGTCAATGG - Intronic
938090998 2:128434707-128434729 CTGAAGAACGGCACTGTGGCAGG - Intergenic
938596995 2:132797927-132797949 CTGAAGGATGGCACTGTGGCAGG + Intronic
938954192 2:136283111-136283133 CTGAGGAAAGGCACCTTGGGTGG - Intergenic
940071036 2:149688127-149688149 CTGAACAGTGGCAAGGTGGATGG - Intergenic
944839084 2:203608206-203608228 CTGAGCAGTGGTACAGTGGATGG - Intergenic
944931645 2:204526268-204526290 CTGAGGATTAGCATGGTGGGTGG - Intergenic
945062997 2:205924848-205924870 CTGTGGAATGGCGCCGTGGGCGG + Intergenic
945887941 2:215396856-215396878 CTGAAGAAAAGCACTGTGGAAGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
949035636 2:241814650-241814672 CTGAGGAGGGGCACGCTGGCCGG + Exonic
1169417678 20:5431873-5431895 CTGAGGCATGGGACAGTGGAGGG - Intergenic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1171462950 20:25309141-25309163 CTGAGGGAGGGCACAGTGGGTGG - Intronic
1172174933 20:32966528-32966550 CAGAGGAAGGACACGGGGGAAGG + Intergenic
1172630965 20:36377952-36377974 CCGAGGAGTAGCAGGGTGGACGG - Intronic
1173501358 20:43556445-43556467 CTGAGGAATGTCAAAGTGAAGGG + Intronic
1174123587 20:48286498-48286520 CTGAGTCCTGGCAAGGTGGAAGG + Intergenic
1175119593 20:56707847-56707869 CTGAGGAATGCCAGGATGGATGG - Intergenic
1175305792 20:57974634-57974656 CTGAGGACTGGCAAGGAGGCTGG - Intergenic
1177187506 21:17814228-17814250 CTAAGGAATGGCAAAGAGGAAGG - Intronic
1179674001 21:42969518-42969540 CTGGGGATGAGCACGGTGGATGG + Intergenic
1179880853 21:44292843-44292865 CGGAGGGCTGGCATGGTGGAAGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181626945 22:24128734-24128756 CTGAGGTATGGCTAGGTGAAGGG + Intronic
1183350289 22:37331058-37331080 CTGAGGAATGGGACAGGGAAAGG + Intergenic
1183536717 22:38406057-38406079 CTTAGGAAGGCCAAGGTGGACGG - Intergenic
1184915561 22:47566419-47566441 CTGAGGTCTGTCATGGTGGAGGG + Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
949920107 3:8993627-8993649 CAGAGGAATGCCATAGTGGAGGG - Intronic
950110473 3:10415399-10415421 GTGAGGAGAGGCACAGTGGAAGG + Intronic
950300044 3:11868932-11868954 CTGAGGAATGGGACAGAGAATGG - Intergenic
952407347 3:33016216-33016238 CAGAGGAAAAGCATGGTGGAGGG + Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
956368195 3:68529235-68529257 GTGAAGAAGGGCAGGGTGGAGGG - Intronic
958880630 3:99665104-99665126 CTGAGAAATGGCAACATGGAAGG - Intronic
959828022 3:110824004-110824026 TTGAGGAATGGCACACTGGATGG - Intergenic
961155701 3:124677838-124677860 CTTGAGAAGGGCACGGTGGATGG - Intronic
961168895 3:124781823-124781845 CTGAGGAGTTGCACAGTGGAGGG - Intronic
961215039 3:125153006-125153028 AAGAGGAGTGGCAGGGTGGACGG - Intronic
961654988 3:128436199-128436221 CTGAAGACTGGAAGGGTGGAAGG + Intergenic
964390051 3:156187204-156187226 CTGAGAAATACCAAGGTGGAGGG - Intronic
964689803 3:159437587-159437609 CGGAGGAAGGAGACGGTGGAGGG + Intronic
966415135 3:179681531-179681553 CTGAGGACGCGCTCGGTGGATGG - Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967769486 3:193319063-193319085 CTGAGGAGTTACACGGTGCAAGG - Exonic
968160743 3:196424627-196424649 CTTTGGAATGCCAAGGTGGAAGG - Intronic
968563367 4:1296390-1296412 GTGAGGAATGGCATGGGTGACGG - Intronic
969091306 4:4695849-4695871 CTGGGGGATGGCACAGGGGATGG - Intergenic
969424850 4:7118194-7118216 CTGAGGAATGGAGAGATGGATGG + Intergenic
969853019 4:9977040-9977062 CAGAGTAATGGCAGTGTGGATGG - Intronic
970824111 4:20252766-20252788 CTGGAGAATGGCTCGGTGGCAGG - Intergenic
978949929 4:114545773-114545795 ATGAGAGATGGCAAGGTGGAAGG + Intergenic
980437473 4:132796575-132796597 CTGAGAGATGGCAGAGTGGAAGG + Intergenic
983954921 4:173686330-173686352 CAGAGGAATGTCCTGGTGGATGG - Intergenic
985985885 5:3515889-3515911 GTGGGGACTGGCAAGGTGGAAGG + Intergenic
991034318 5:62112851-62112873 CTGAGGAATGCCAGTGTGGGTGG - Intergenic
995043930 5:107622252-107622274 CTAAGGAATGGCACAGTAGTGGG + Intronic
995751072 5:115453799-115453821 CTGAGGCTGGGCAGGGTGGAAGG - Intergenic
996573711 5:124960290-124960312 CTCAGGAATTGCAGGGTGCAGGG - Intergenic
996823896 5:127660059-127660081 CTGAGGAAGGGCACGGAAGCTGG - Intergenic
997228218 5:132225476-132225498 CTGAGGAATGAGTCGGTTGAGGG - Intronic
998061220 5:139120201-139120223 CTCAGGAGTGGCAAGGTGGATGG - Intronic
999274975 5:150324176-150324198 CTGAGGATAGGCACGGTGGCAGG + Intronic
999816933 5:155186456-155186478 GTCTGGAGTGGCACGGTGGAGGG + Intergenic
1002026889 5:176401829-176401851 CTGATGACTTGCACGGGGGATGG - Intronic
1002100990 5:176857556-176857578 CTCAGGAATAGCAAGGAGGAGGG - Intronic
1002330024 5:178434748-178434770 CTGAGGCCTGGGATGGTGGAGGG + Intronic
1003507762 6:6753518-6753540 CTGAGGAACCGCCAGGTGGAAGG - Intergenic
1006075771 6:31531304-31531326 CTGGGGCATCCCACGGTGGATGG + Exonic
1006370646 6:33641705-33641727 GTGAGGAATGGCAGGGAGGCTGG - Intronic
1007151673 6:39699246-39699268 GTGAGGAATGCCATGGTGGTTGG + Intronic
1007298199 6:40844944-40844966 GTGAGGAAGGGTACAGTGGAAGG + Intergenic
1007514128 6:42397857-42397879 CAGAGCAGTGGCACTGTGGAGGG + Intronic
1008395642 6:51003598-51003620 AGGAGGCATGGCATGGTGGAAGG + Intergenic
1008627938 6:53335976-53335998 CTTATGAAAGGCAGGGTGGATGG - Intronic
1010455242 6:76047145-76047167 CTGAGGAATAGCACAGTGAAAGG - Intronic
1011602978 6:89077232-89077254 CTCACGGATGGCAAGGTGGATGG - Intergenic
1011836923 6:91442910-91442932 CTCAGGAATGGCAGGAGGGAAGG + Intergenic
1012094006 6:94934660-94934682 CTGAGGGAAGTCATGGTGGAGGG - Intergenic
1013074443 6:106758827-106758849 CTCAGGCATGGCAGTGTGGAGGG - Intergenic
1015416631 6:132956533-132956555 CTTAGCAATAGCACTGTGGAGGG - Intergenic
1017132021 6:151115609-151115631 CTGAGGGAGGGCACGGTGCTGGG - Intergenic
1017618396 6:156269724-156269746 CAGAGGTAGGGCAAGGTGGAAGG - Intergenic
1020897080 7:13953564-13953586 CTGAGGAATGCTACGGCAGATGG + Intronic
1023577550 7:41645367-41645389 GTGATGAATGGCAGTGTGGATGG - Intergenic
1027049127 7:75010562-75010584 CTGGGGAATGGCAGGGTCGAGGG - Intronic
1027878590 7:83802703-83802725 CTTTGGAATGCCAAGGTGGATGG + Intergenic
1029383893 7:100231085-100231107 CTGGGGAATGGCAGAGTCGAGGG + Intronic
1032545603 7:132739105-132739127 CAGAGGGATGGCAGTGTGGAGGG + Intergenic
1033124667 7:138697125-138697147 CTTTGGGATGCCACGGTGGAAGG + Intronic
1033277800 7:139985805-139985827 CTGAGGAATGAATGGGTGGACGG + Intronic
1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG + Intronic
1034269172 7:149795334-149795356 CTCAGGGATGGCACGCTGGAGGG + Intergenic
1034844271 7:154430024-154430046 CTGAGAACTGGGAGGGTGGATGG - Intronic
1035998574 8:4576380-4576402 CTGGGGAATGGGACAGGGGAAGG - Intronic
1038013613 8:23494546-23494568 CTGAGGCATGGCAGGTTGGCAGG - Intergenic
1038326632 8:26577324-26577346 CTGAGGACTGGAACGGCGGCGGG - Intronic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1039414919 8:37385701-37385723 CTGTGGAATGCCACTGCGGAAGG - Intergenic
1040571320 8:48614032-48614054 CTTAGGAATTGCACTCTGGATGG - Intergenic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1045483619 8:102612763-102612785 CCTAGGAATGGCATGGTGGTGGG + Intergenic
1048204761 8:132406479-132406501 CTCAGGAATGGAATTGTGGAGGG - Intronic
1049294418 8:141823600-141823622 CTGAGGAAGGGCACTGTGACTGG - Intergenic
1049313778 8:141948009-141948031 CTCAGGCATGGTAGGGTGGAGGG + Intergenic
1049329098 8:142040307-142040329 CCGAGAAATGGCAAGCTGGAGGG - Intergenic
1050747393 9:8892173-8892195 CTGAGGAAAAGCAGCGTGGATGG - Intronic
1053198155 9:36136031-36136053 CTGAGGAAAGGCAGGGAGGTGGG + Intergenic
1057328044 9:94084558-94084580 CTGAGGAAGCGCACGGCTGAGGG - Exonic
1057572695 9:96216432-96216454 CAGAGGAATGGGACAGGGGATGG + Intergenic
1058749101 9:108021385-108021407 ATGAGGAGTGGAATGGTGGAGGG + Intergenic
1060990278 9:127845050-127845072 CTGAGGAATGTGCCGGGGGAAGG + Intronic
1061803056 9:133122481-133122503 CTGAGGATTGGCACTTGGGAAGG - Intronic
1061934913 9:133852104-133852126 CTGAAGAATGGATGGGTGGATGG + Intronic
1062180623 9:135189296-135189318 GTGAGGTGTGGCATGGTGGAGGG - Intergenic
1062180681 9:135189471-135189493 GTGAGGTGTGGCATGGTGGAGGG - Intergenic
1062180698 9:135189524-135189546 GTGAGGTGTGGCATGGTGGAGGG - Intergenic
1062180709 9:135189559-135189581 GTGAGGTGTGGCATGGTGGAGGG - Intergenic
1062595436 9:137297021-137297043 CGGAGGACAGCCACGGTGGAGGG - Intergenic
1062712373 9:137983473-137983495 CTGAGGAATGGCTGGAAGGAGGG + Intronic
1185583364 X:1227375-1227397 CTGAGGAATGGGTGGATGGATGG + Intergenic
1186014305 X:5173825-5173847 CTGAGTAATGGCTCCTTGGATGG + Intergenic
1186309475 X:8302150-8302172 CTCTGGAAGGGCATGGTGGATGG + Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186720733 X:12300903-12300925 CTGTAGGATGGCAAGGTGGAAGG - Intronic
1186870197 X:13764056-13764078 CTGAGAAAGGACACGTTGGAAGG + Intronic
1187500347 X:19833606-19833628 CTGTGGAAAGGCGAGGTGGATGG - Intronic
1187921096 X:24202650-24202672 CTGGGGAATGCCACAGTTGAAGG - Intronic
1188987082 X:36777585-36777607 CTGAGGAAGGGCATGGTAGGAGG - Intergenic
1189068941 X:37844338-37844360 CTGGGGAATGGGACTGGGGATGG - Intronic
1198221088 X:134603196-134603218 CTGAGGAGTGGGACTGGGGATGG + Intronic
1199673003 X:150162176-150162198 CTGAGGAATGGCAATAGGGAAGG + Intergenic
1200594863 Y:5125975-5125997 CTGACGAATGAGATGGTGGAGGG + Intronic