ID: 907834119

View in Genome Browser
Species Human (GRCh38)
Location 1:58093169-58093191
Sequence TCAATCTCCTGTACAAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907834116_907834119 -4 Left 907834116 1:58093150-58093172 CCCACTCAGCAATATCTGTTCAA 0: 1
1: 0
2: 0
3: 10
4: 146
Right 907834119 1:58093169-58093191 TCAATCTCCTGTACAAGTGGAGG 0: 1
1: 1
2: 0
3: 7
4: 79
907834115_907834119 -3 Left 907834115 1:58093149-58093171 CCCCACTCAGCAATATCTGTTCA 0: 1
1: 0
2: 2
3: 10
4: 190
Right 907834119 1:58093169-58093191 TCAATCTCCTGTACAAGTGGAGG 0: 1
1: 1
2: 0
3: 7
4: 79
907834117_907834119 -5 Left 907834117 1:58093151-58093173 CCACTCAGCAATATCTGTTCAAT 0: 1
1: 0
2: 0
3: 11
4: 189
Right 907834119 1:58093169-58093191 TCAATCTCCTGTACAAGTGGAGG 0: 1
1: 1
2: 0
3: 7
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907834119 Original CRISPR TCAATCTCCTGTACAAGTGG AGG Intronic
907834119 1:58093169-58093191 TCAATCTCCTGTACAAGTGGAGG + Intronic
909693066 1:78432166-78432188 GCAAACTCATGTACAAGAGGAGG - Intronic
917692420 1:177482888-177482910 TAAATTTGATGTACAAGTGGGGG + Intergenic
1063241566 10:4175014-4175036 TCAGTTTCCTGCACACGTGGAGG + Intergenic
1064045887 10:12014845-12014867 TCAATCTACTGTGCAAGTACTGG + Intronic
1069045045 10:63734740-63734762 TCAATCTTCAGTGCAACTGGGGG - Intergenic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1080618871 11:33969644-33969666 TCCATCTCCTGAACCAGAGGTGG - Intergenic
1084433307 11:69123413-69123435 TGAATCTCCTCTACCCGTGGTGG + Intergenic
1086059337 11:82684080-82684102 TCCATCTCATGGACAAGTTGTGG + Intergenic
1092297306 12:7210591-7210613 TCAATTCCCAGTAAAAGTGGGGG - Intronic
1092695404 12:11166201-11166223 TCAATGTCTTGTATCAGTGGAGG + Intronic
1093391103 12:18623339-18623361 TCAATTGACTGTACATGTGGGGG + Intronic
1093446625 12:19267304-19267326 TCAGTATTCTCTACAAGTGGTGG - Intronic
1101814853 12:108138225-108138247 CCAATGTCCTGTCCCAGTGGTGG - Intronic
1107161782 13:37239004-37239026 CAAATCTCCTGTAGAATTGGAGG - Intergenic
1109212033 13:59546197-59546219 TCAATCTCTTCTATAAGTGCTGG - Intergenic
1115796809 14:36946347-36946369 TCTTTCTCCTGTACAAATGATGG - Intronic
1118207629 14:63738122-63738144 TCAAACTCCTGGGCAAGTGCTGG + Intergenic
1120885308 14:89447325-89447347 TCACTCTCCTGTATGACTGGTGG - Intronic
1126330917 15:47530226-47530248 TGAATCTCCTTTAGAAATGGTGG + Intronic
1127109227 15:55649878-55649900 TCCCTCTCATGTACAAGTGCAGG + Intronic
1127662453 15:61112921-61112943 TCAATGTCCTCTTTAAGTGGTGG + Intronic
1135846744 16:25925728-25925750 TCTATCTCCTGTGCTAATGGAGG - Intronic
1137696426 16:50465043-50465065 TCATACTCCTGCACCAGTGGAGG - Intergenic
1143180838 17:4983036-4983058 GCAATCTCCTGTAGGAGAGGAGG + Exonic
1155474199 18:26221777-26221799 TTAATCTAGTGCACAAGTGGAGG - Intergenic
1155494028 18:26425376-26425398 CCCATCTCCTAGACAAGTGGTGG - Intergenic
1165074211 19:33271895-33271917 TCCATCTCCAGCCCAAGTGGAGG + Intergenic
1165769943 19:38374160-38374182 TCAATGTCATGTGTAAGTGGAGG - Intergenic
930252771 2:49054176-49054198 CCTATCTCCTGTGCAACTGGGGG + Intronic
937008501 2:118540315-118540337 TCAATCTACTGTACAAGTGGGGG + Intergenic
940272232 2:151903759-151903781 TCAGTCTCCTGTGCAAGAGCAGG - Intronic
940281719 2:151995903-151995925 TCATTCTCCTGAACTAGTGGAGG + Intronic
945413511 2:209541811-209541833 TTAATATTCTGTACATGTGGTGG - Intronic
946714122 2:222535413-222535435 TTCATCTCTTTTACAAGTGGAGG + Intronic
1171511489 20:25688906-25688928 TCAATCTCCTGACCACGAGGAGG - Intronic
1173664674 20:44755603-44755625 TCAAGCTCCTCTTCAAGTGGGGG + Intronic
1180121406 21:45750983-45751005 TCACTGTCATGTACAAGGGGTGG - Intronic
1180148330 21:45934294-45934316 TCCATTTCCTGGACAAGTGGCGG - Intronic
1181421900 22:22806397-22806419 TAAATCTACTGAACCAGTGGAGG - Intronic
950713658 3:14832107-14832129 TTTCTCACCTGTACAAGTGGTGG + Intronic
952771863 3:37008798-37008820 TCAATCTTCTGTTCAGGTGGAGG + Exonic
955575788 3:60361431-60361453 TCAACCTCCTCTACAGTTGGTGG - Intronic
958689598 3:97446682-97446704 TCAATCTCATATACAAGAGGAGG - Intronic
960042673 3:113166616-113166638 TTAATCTCCTCTATAAGAGGGGG - Intergenic
960117436 3:113910792-113910814 TCAATCTCCTCCCCAACTGGAGG + Intronic
962818646 3:139025072-139025094 TAAATCAACTGCACAAGTGGAGG - Intronic
962925451 3:139989035-139989057 TCAATCTGCTTTACAATTTGGGG + Intronic
966508485 3:180734112-180734134 GCAATCTCCTGTACCACTTGTGG - Intronic
967209127 3:187150898-187150920 ACAAGCTCCTGTTCCAGTGGAGG - Intronic
976419399 4:84822518-84822540 TAAATCTCTTGTAGAAATGGAGG - Intronic
977758550 4:100702603-100702625 TCATTCTCCTGAAGAAGTTGAGG + Intronic
977928005 4:102722896-102722918 TCACCCTTCTGCACAAGTGGAGG + Exonic
983271620 4:165568735-165568757 TCAATTTCCTGTAAAAGGGAAGG + Intergenic
984582234 4:181523654-181523676 TCAATTTGCTGTAGAAGGGGAGG - Intergenic
987987031 5:25161222-25161244 TGCATTTCCTGGACAAGTGGGGG + Intergenic
989016858 5:36946182-36946204 TCAATCATCTCTCCAAGTGGTGG + Intronic
990412149 5:55552108-55552130 TCAATCCCATGTACATGAGGTGG + Intergenic
990527412 5:56641533-56641555 TCAATCCAATGTACAATTGGGGG + Intergenic
997467564 5:134098580-134098602 TCAACCTCCTGGACAGGTGGTGG + Intergenic
1000716213 5:164648047-164648069 TCAATCTCCTTTCCAAGATGTGG + Intergenic
1004286245 6:14323195-14323217 TCAGTCACCTGTACAGATGGAGG + Intergenic
1007666958 6:43520051-43520073 TTCATCTCCTGCACAAATGGAGG - Exonic
1010512598 6:76738957-76738979 TAAATGCCCTATACAAGTGGTGG - Intergenic
1014588180 6:123227853-123227875 TGAATCTACTGTACAAATAGAGG + Intronic
1019489755 7:1306750-1306772 TGAAGCTCATGTACCAGTGGGGG + Intergenic
1021317845 7:19172040-19172062 TCTATCTCCTTTCCCAGTGGTGG + Intergenic
1021728058 7:23568948-23568970 TCAATCTCCTGACCTAGTGATGG + Intergenic
1023132012 7:37012918-37012940 CCAATCTCCTGGACAGGTGGAGG + Intronic
1023443255 7:40205825-40205847 TCAATCTCCTGTTAAAGTTTTGG - Intronic
1026565940 7:71489827-71489849 TCAATCTCCTGTATGGCTGGGGG + Intronic
1034184727 7:149166531-149166553 TCAAGCTCCTTTCCAAGTGAAGG - Intronic
1035193851 7:157198240-157198262 TCAATGTCATTTACAGGTGGAGG - Intronic
1041810349 8:61902049-61902071 TCAAGCTCCTATTCAAATGGAGG - Intergenic
1042889115 8:73587481-73587503 TCAATCTGCAATACAAGAGGAGG + Intronic
1044616603 8:94148756-94148778 TCCATATCGGGTACAAGTGGTGG - Exonic
1049639553 8:143708633-143708655 TGAAGCTCCTCTTCAAGTGGGGG - Intronic
1052016225 9:23471432-23471454 TGAATCTCCTCTCCTAGTGGAGG - Intergenic
1057099430 9:92344033-92344055 TCATTCTCCTCTACAACTGAAGG - Intronic
1185821364 X:3207883-3207905 TCCATCTGCTGTACAGGTAGGGG + Intergenic
1186872018 X:13782636-13782658 TCAGCCTCCTGTACAAGTCAGGG - Intronic
1191642039 X:63436594-63436616 TCACTCTCCTGTACCAATTGTGG - Intergenic
1195220722 X:102743652-102743674 TCAATCTCCTGAAGAATTTGGGG + Intronic
1195379738 X:104259305-104259327 TAAATCTCCTGTACTGCTGGTGG - Intergenic
1197745016 X:129926610-129926632 TCATTCTCCTGAACAAGTACCGG - Intronic
1199272232 X:145898191-145898213 TCAATCTCCAGTCCAATAGGTGG + Intergenic
1201257519 Y:12123822-12123844 TCCATCTGCTGTACAGGTAGGGG - Intergenic