ID: 907834232

View in Genome Browser
Species Human (GRCh38)
Location 1:58093865-58093887
Sequence AGGGGCAAGCAGGCCAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 963
Summary {0: 1, 1: 0, 2: 9, 3: 78, 4: 875}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907834232 Original CRISPR AGGGGCAAGCAGGCCAGGAG AGG (reversed) Intronic
900184874 1:1328332-1328354 AGGGGCAAACAAGGCAGGAGAGG - Exonic
900997396 1:6129973-6129995 AGGAGGAAGCAGGCTTGGAGAGG - Intronic
901059450 1:6465389-6465411 TGGGGCAGGCAGGGCTGGAGAGG - Intronic
901180654 1:7339496-7339518 ATGGCCAAGCAGGGCAGGAAGGG - Intronic
901230792 1:7640816-7640838 AGGAAGAAGCAGGCCAAGAGTGG + Intronic
901431975 1:9221925-9221947 TGGAGCAAGCAGGCCAGGTGAGG - Intergenic
901457431 1:9371296-9371318 AGGGGGCAGCAGGGGAGGAGTGG + Intergenic
901789445 1:11646709-11646731 AGGGGCCAGGAGGCCAGGTAGGG - Intergenic
902179688 1:14678470-14678492 AGGAGCAAGGAAGCCAGCAGTGG - Intronic
902261315 1:15226880-15226902 TGGAGCAGGCTGGCCAGGAGAGG + Intergenic
902306716 1:15546012-15546034 AAGAGCAAGCTGGCCTGGAGTGG + Intronic
902420497 1:16275716-16275738 AGGACAAAGGAGGCCAGGAGTGG + Intronic
902628813 1:17692641-17692663 AGGAGCAAGGAGCCCAGCAGGGG - Intronic
902686213 1:18079315-18079337 AGGGGAGGGCAGGGCAGGAGGGG + Intergenic
902811618 1:18891187-18891209 AGGGGGAAACAGGCCTGAAGGGG - Intronic
902916690 1:19644110-19644132 CGGGGCGGGCGGGCCAGGAGAGG + Intronic
903218658 1:21856705-21856727 AGGTGGGAGAAGGCCAGGAGCGG - Intronic
903345311 1:22680592-22680614 AGGGCTAATGAGGCCAGGAGAGG - Intergenic
903377606 1:22876528-22876550 AGGGGGAGGCCGGCCAGGCGGGG - Intronic
904054040 1:27658701-27658723 AGAGGGAAGGAGGCAAGGAGGGG + Intergenic
904276855 1:29390565-29390587 AGGGGCAGCCAGTGCAGGAGGGG + Intergenic
904288906 1:29471229-29471251 AGGGGAAGACAGGCAAGGAGGGG + Intergenic
904354684 1:29931188-29931210 AGGGGCAGGCAGGTAAGGACTGG - Intergenic
904667933 1:32138252-32138274 AGGTGGAAGCTGGCCAGGCGCGG + Intronic
904679906 1:32222076-32222098 TGGGGCTAGAAGGCCAGGAGAGG - Intronic
904840133 1:33367337-33367359 AGGGCCAAGCTGGGCAGGACAGG + Exonic
904909231 1:33921666-33921688 AGAGGCAAGAAGGCCTGGAAGGG + Intronic
905361965 1:37427039-37427061 AGGAGCAAAAAGGCCAGGTGCGG + Intergenic
905375309 1:37516207-37516229 AGGGGAATGCAGGCCGGGCGCGG + Intergenic
906509175 1:46401105-46401127 AGGGGGAAGCAGGCCAGGGGAGG + Intronic
906757596 1:48333419-48333441 AGGAGCAAGGAAGCCAGTAGTGG - Intronic
906771722 1:48491111-48491133 AACGGCAAGCTGGCCAGGTGTGG + Intergenic
907079668 1:51609639-51609661 AGGCGGTAGCTGGCCAGGAGTGG - Intronic
907815713 1:57916645-57916667 AGGGTTAAGTAGGCCAGGCGTGG + Intronic
907834232 1:58093865-58093887 AGGGGCAAGCAGGCCAGGAGAGG - Intronic
907940694 1:59084365-59084387 AGGGGAGAGCCTGCCAGGAGGGG - Intergenic
910294172 1:85628003-85628025 AGGGGCAAGTAGGACCAGAGAGG - Intergenic
910460415 1:87443086-87443108 AGTGGCAAGCAAGGTAGGAGAGG - Intergenic
910461674 1:87454151-87454173 AGGCATAAGCAGGGCAGGAGAGG - Intergenic
910943091 1:92558192-92558214 AGGGTCAAGAGAGCCAGGAGAGG - Intronic
910989126 1:93036843-93036865 AGGAGACAGCAGCCCAGGAGAGG + Intergenic
911156650 1:94643703-94643725 TGGGGCACGAAGGACAGGAGGGG - Intergenic
911749543 1:101480790-101480812 AGGTGTGAGCAGGGCAGGAGAGG + Intergenic
912083112 1:105962859-105962881 AGGAGCAAGGAAGCCAGAAGCGG - Intergenic
912842759 1:113053298-113053320 AGGACCAAGGAGGCCAGGTGTGG + Intergenic
913157660 1:116115831-116115853 AGGGGAAAGCAGCCCAAGATGGG + Intronic
914317641 1:146529366-146529388 AGTGGCCAGCAAGGCAGGAGAGG - Intergenic
914318895 1:146540444-146540466 AGGCATAAGCAGGGCAGGAGTGG - Intergenic
914495463 1:148192913-148192935 AGGCATAAGCAGGGCAGGAGTGG + Intergenic
914496715 1:148203994-148204016 AGTGGCCAGCAAGGCAGGAGAGG + Intergenic
914703874 1:150155943-150155965 AGAGGGAGGCACGCCAGGAGAGG - Intronic
914760245 1:150592852-150592874 AGGGTAAACCAGGCCAGGTGCGG - Intergenic
914866236 1:151431876-151431898 AGAGTCAAGCAGGCCAGGCATGG + Intronic
914929630 1:151919468-151919490 AGGAGCAATCAGGCCGGGTGCGG + Intergenic
915123601 1:153648178-153648200 AGGGGCAAGGAAGGAAGGAGAGG + Intergenic
915168058 1:153959535-153959557 AGGAGTAAGCAGGACTGGAGAGG + Exonic
915278604 1:154807163-154807185 TGAGGCAAGCAGGAAAGGAGAGG + Intronic
915307243 1:154987644-154987666 AGAAGAAAGCAGGCCAGGCGTGG + Intronic
915319360 1:155047777-155047799 TGGGGCAGGCAGGCTAGGGGAGG - Exonic
915449330 1:155993831-155993853 AGGGGCAGGAAGGGCAGGAAGGG + Intronic
915569650 1:156737614-156737636 AGGGGCAGGAAGGTCAGGGGTGG - Intronic
915594278 1:156887509-156887531 AATGACAAGGAGGCCAGGAGGGG + Intergenic
915949602 1:160179987-160180009 GGGAGCAAGCAGCCCAGGTGGGG + Intronic
916005723 1:160658358-160658380 AGGGGCAAGAAGGCCAGATAAGG + Intergenic
916023591 1:160815048-160815070 AGGGACTAGGAGGCCAGGTGCGG + Intronic
916087468 1:161281583-161281605 ACGGGGCAGCTGGCCAGGAGGGG + Intronic
916171003 1:162001682-162001704 TGTGGAAAGCAGGCTAGGAGAGG - Intronic
916209967 1:162352347-162352369 AGGAGCCTGCAGGCCAGGCGCGG - Intronic
916231951 1:162549425-162549447 AAGGGCAAGGGGGCCAGGTGTGG + Intergenic
916694265 1:167220814-167220836 GGAGGCAAGCAGGGCGGGAGGGG + Exonic
917780386 1:178389052-178389074 AGGGGCCAGGAGGCCAGAAATGG + Intronic
917837913 1:178955300-178955322 AGGGGCAGGGAGGCCAGCACTGG - Intergenic
918160813 1:181897656-181897678 AGGAGCAAGGACGCCAGTAGTGG + Intergenic
918398289 1:184138129-184138151 AAGAGCAAGGAGGCCAGGTGTGG - Intergenic
918967599 1:191372158-191372180 AGGCACGAGCAGGACAGGAGAGG - Intergenic
919723944 1:200870052-200870074 TGGGGCAAGCAGACCAAGAGGGG - Intergenic
919734778 1:200939899-200939921 ACGGAAAAGCAGGCCAGGCGTGG - Intergenic
919958307 1:202439870-202439892 TGGGGCAAGCAGGGCAGGAGGGG - Intronic
920500106 1:206480322-206480344 AGGGGGAGGCAGGCCAGAGGGGG + Intronic
920535321 1:206733362-206733384 AGGGGCAGGCAGGGCTGCAGAGG + Exonic
920751163 1:208678687-208678709 AGGGGGAAGCTGGCCGGGTGCGG + Intergenic
922250284 1:223843457-223843479 ATGTGCAAATAGGCCAGGAGCGG - Intronic
922484827 1:225965530-225965552 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
922546270 1:226459572-226459594 AGGAGCAAGAAAGCCAGCAGTGG - Intergenic
922766827 1:228160354-228160376 AGGGGTGTGCAGCCCAGGAGGGG - Intergenic
922801941 1:228368450-228368472 TGGGGCCTGCAGGCCAGGTGGGG + Intronic
923200346 1:231704964-231704986 AGGAGTATGCAGTCCAGGAGGGG + Intronic
923661168 1:235958584-235958606 AGACACAAGCAGGGCAGGAGAGG - Intergenic
924135095 1:240957394-240957416 AGGAGCAAGGAAGCCAGTAGTGG - Intronic
924603324 1:245510636-245510658 AGAGGCAGGCAGGCAGGGAGGGG - Intronic
1062823427 10:551330-551352 AGGGGCAGGCATGCCAGGGTAGG + Intronic
1062824472 10:557793-557815 AGGGGCAGGCAGGCAGGCAGGGG + Intronic
1062824500 10:557861-557883 AGGGGCAGGCAGGCAGGCAGGGG + Intronic
1063570963 10:7214057-7214079 AGGAGCAACCAGGAAAGGAGTGG + Intronic
1063837229 10:10029584-10029606 GTGGGCAAACAGGCCAGGCGAGG + Intergenic
1064177854 10:13090866-13090888 AGGAGCAAGGAAGCCAGTAGTGG + Intronic
1064336634 10:14448855-14448877 AGGGGCAGGAAGGGCAGGGGAGG + Intronic
1064666499 10:17657334-17657356 AGGTACGAGCAGGGCAGGAGAGG - Intronic
1065028326 10:21560287-21560309 AAGGCCAAACAGGCCAGGCGTGG - Intronic
1065812070 10:29451445-29451467 AGGGGCCTGCATTCCAGGAGAGG - Intergenic
1065875654 10:29995265-29995287 AGGGGAAAACAGGCCAGAGGAGG + Intergenic
1066220845 10:33335445-33335467 AGGGGAAAGCCGGGCTGGAGTGG + Intronic
1066551332 10:36561128-36561150 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1066553601 10:36586659-36586681 AAATGCAAACAGGCCAGGAGGGG + Intergenic
1066667820 10:37803395-37803417 AGGGGCAGGCAGCACAGGAGAGG - Intronic
1066678236 10:37911194-37911216 AGGGGCAAACAAATCAGGAGAGG - Intergenic
1067216876 10:44310832-44310854 AGAGGCAGGCAGGCCAGGAGCGG + Intergenic
1067357732 10:45546489-45546511 AGAATAAAGCAGGCCAGGAGTGG + Intronic
1067705626 10:48604762-48604784 AAGATCAGGCAGGCCAGGAGGGG - Exonic
1068583654 10:58771977-58771999 AGAAGAAAGCATGCCAGGAGTGG + Intronic
1068600790 10:58954353-58954375 AGGCATAAGCAGGGCAGGAGAGG + Intergenic
1068998923 10:63241933-63241955 AGAGGAAAGCAGGTAAGGAGAGG + Intronic
1069605253 10:69735024-69735046 AAGGTCAAGGAGGCCTGGAGAGG + Intergenic
1069716251 10:70523234-70523256 GGGGGCAGGCAGGGGAGGAGAGG + Intronic
1069844254 10:71359713-71359735 AGGAGGAAGCAGGCCCAGAGAGG + Intronic
1070561799 10:77573400-77573422 AGGGGCAGGCTGGGCAGGGGTGG + Intronic
1070807314 10:79278208-79278230 AGGGGCAATCAGGCCCAGGGAGG - Intronic
1071473867 10:86008103-86008125 AGGGGTAATCAGGCCAACAGGGG - Intronic
1071506963 10:86238369-86238391 AGGGCCAAGGTGGCCAGGGGTGG + Intronic
1072476449 10:95765010-95765032 ATGGGCAAAGAGGCCAGGCGTGG - Intronic
1073062279 10:100739904-100739926 AGGGGACAGCTGGCCAGGTGGGG + Intronic
1073360093 10:102891311-102891333 AGGCGTGAGCAGGGCAGGAGAGG - Intronic
1073675672 10:105644561-105644583 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1074033534 10:109713930-109713952 AGGTACGAGCAGGGCAGGAGAGG + Intergenic
1074180821 10:111061338-111061360 TGGGGCATGCCTGCCAGGAGTGG + Intergenic
1074287384 10:112110827-112110849 AGGTGAGAGCAGGGCAGGAGAGG - Intergenic
1074602724 10:114931579-114931601 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1074707991 10:116152469-116152491 AGGGGCAAGAGGCCCAGCAGAGG + Intronic
1075028187 10:119002439-119002461 AGTGGCAGACAGGCCAGGAGGGG - Intergenic
1075165707 10:120066543-120066565 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1075242213 10:120789456-120789478 TGGGGCCAGAAGGCCAGGAACGG - Intergenic
1075649651 10:124119256-124119278 AAGGGGAGGCAGGCCAGGGGAGG + Intergenic
1076108964 10:127846517-127846539 AGGGGCAAAGAGCCAAGGAGAGG - Intergenic
1076232201 10:128830752-128830774 AGGGGTATACAGGCCAGGTGCGG + Intergenic
1076429697 10:130393157-130393179 CGTGTCATGCAGGCCAGGAGGGG + Intergenic
1076446216 10:130516076-130516098 AGGGGTTTGCAGGACAGGAGGGG - Intergenic
1076495210 10:130892714-130892736 AGGGGTGAGCAGCCCAGGAGAGG + Intergenic
1076761844 10:132609930-132609952 AGCGGCAGACAGGCCAGGTGCGG - Intronic
1077083657 11:736496-736518 AGGGGAAAGCAGGGCCGGGGTGG + Intergenic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1077884984 11:6380740-6380762 AGGGGCCAGCAGGCAAGAAGAGG + Intergenic
1077896615 11:6457905-6457927 AGGGGCAGGGAGGGCAGGTGGGG - Intronic
1077964157 11:7109623-7109645 AGTGGAAAGTAGGCCAGGTGTGG - Intergenic
1078174932 11:8963670-8963692 GGAGGGAAGTAGGCCAGGAGGGG + Intronic
1078256621 11:9664132-9664154 AGGGGCTGGCTGGGCAGGAGGGG + Exonic
1078920494 11:15826162-15826184 AGGAGAGAGCAGGCCTGGAGAGG - Intergenic
1079234565 11:18678881-18678903 AGGCATAAGCAGGGCAGGAGGGG + Intergenic
1079248741 11:18772188-18772210 AGAGGCAAGCAGGGCACCAGGGG - Intronic
1079805436 11:24924366-24924388 AGGGGCAAGCGGGCTGGGTGCGG - Intronic
1079991333 11:27249700-27249722 AAGGGGAAGGTGGCCAGGAGAGG + Intergenic
1080077021 11:28161364-28161386 AGGTGCAAGCAGGCCAAGGCAGG - Intronic
1080468520 11:32521774-32521796 AGGGGCCAGCAGGGCTGGAATGG - Intergenic
1080891186 11:36410394-36410416 AGGGGCAGGCAGGCAAAGAAGGG - Intronic
1081159088 11:39731781-39731803 AGGCATAAGCAGGGCAGGAGAGG - Intergenic
1081634401 11:44711315-44711337 AGAGGCCAGCAGGCCAGGCTGGG + Intergenic
1081637489 11:44730094-44730116 AGAGGCAAGCCAGCCCGGAGAGG - Intronic
1081921536 11:46782113-46782135 AGAGGCAGGCAGGCCGGGCGCGG - Intronic
1082961654 11:58923689-58923711 AGGGGCAGGCTGGCAAGGAGAGG - Intronic
1083674697 11:64318897-64318919 AGGGGAAATCAGGCCGGGAGTGG - Intronic
1083771703 11:64871187-64871209 ACGGGCTGGCAGGCCAGGGGAGG + Intronic
1083847571 11:65344983-65345005 GGGGGCCAGCAGGAAAGGAGTGG - Intronic
1083938346 11:65882059-65882081 AGGGGCAAAAAGGCAAGGATAGG - Intronic
1083965260 11:66039866-66039888 AGGGCCAGGGAGGCCAGGGGAGG + Intergenic
1084075337 11:66770795-66770817 ATGGGTAAGGAGGCCAGAAGGGG - Intronic
1084165167 11:67372247-67372269 AGGGGCTACCAGGAGAGGAGGGG - Intronic
1084185160 11:67467613-67467635 AGGGGCAGGGAGGCAAGGACGGG + Intronic
1084640401 11:70422681-70422703 AGGGGCAGGAGGGGCAGGAGGGG - Intronic
1084671797 11:70611423-70611445 ATGGGGAAGCAGGGCAGGTGGGG - Intronic
1084675939 11:70634568-70634590 ATGGGCAAACTGGCCAGGTGAGG + Intronic
1085249833 11:75135602-75135624 AGGCCCCAGCAGGCCAGGAAGGG - Intronic
1085399014 11:76224468-76224490 AGGAGCCTGCAGGCCAGGGGTGG + Intergenic
1085408377 11:76277445-76277467 AGAGGCAAGAAGGCCTGGACAGG - Intergenic
1085851960 11:80131012-80131034 ATGGACAAGCTGGCCAGGTGCGG + Intergenic
1086248082 11:84779079-84779101 AGGGGCAAGGAAGCCAGTAGTGG - Intronic
1087194131 11:95287495-95287517 AGGAGCAACCAGGCCGGGCGCGG - Intergenic
1087212061 11:95454626-95454648 AGGGGAAAGCAAGCCTAGAGCGG - Intergenic
1088977258 11:114826885-114826907 AGAGACAAGCAGGCTAGGAGAGG - Intergenic
1089004784 11:115082328-115082350 GGGGGCCACCAGGCCAGGTGGGG - Intergenic
1089270657 11:117299600-117299622 AATGGAAACCAGGCCAGGAGTGG - Intronic
1089690497 11:120184052-120184074 AGTGGAAAACAGGCCGGGAGAGG + Intronic
1089871040 11:121672834-121672856 GGAGGGAAGGAGGCCAGGAGAGG + Intergenic
1090391023 11:126387385-126387407 AAAGGTAAGCAGGCCAGGTGTGG + Intronic
1090395699 11:126416658-126416680 AGGGGCGGGCAGGGCAGGGGAGG + Intronic
1090398545 11:126434467-126434489 AGGGGCATGTCTGCCAGGAGGGG + Intronic
1091140681 11:133231871-133231893 AGGGAGAAGCAGGCAGGGAGTGG + Intronic
1091634517 12:2186994-2187016 AGGGGGCAGCAGGACAGGAAAGG - Intronic
1091875775 12:3931718-3931740 GCGGGTAAGCAGGCCAGGAAGGG - Intergenic
1091974925 12:4816861-4816883 AAGGCAAAGCAGGCCAAGAGGGG - Intronic
1092261799 12:6956834-6956856 TGGGGCAGGGAGGACAGGAGGGG - Intronic
1093859613 12:24148204-24148226 AGGGACAAACAGGCCAGGCATGG + Intergenic
1094208879 12:27869699-27869721 AGCCCCAAGCAGGACAGGAGAGG - Intergenic
1094491016 12:30960657-30960679 GGATGCAAGCTGGCCAGGAGGGG - Intronic
1094589786 12:31809421-31809443 GGAGGGAAGCAGGCCAGGGGAGG - Intergenic
1094832005 12:34304581-34304603 AGCGGCAAGAAGGCCAAGAAGGG + Intergenic
1094834222 12:34314707-34314729 AGAGGCAAGAAGGCCCAGAGAGG - Intergenic
1095096729 12:38153083-38153105 AGCGGCAAGAAGGCCCGCAGGGG + Intergenic
1095500077 12:42828242-42828264 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1095764645 12:45881308-45881330 AGGGGCACACAGACCAGGTGAGG - Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096457971 12:51803089-51803111 AGGAGCAAGGAAGCCAGTAGTGG + Intronic
1096966698 12:55633556-55633578 AGGGTCAAGGAGTCCAGAAGAGG + Intergenic
1097058653 12:56266508-56266530 AGGAGCAAGGAGGCCAGTGGTGG - Intergenic
1097134220 12:56837923-56837945 AGAGGTGAGCAGGGCAGGAGAGG - Intergenic
1097931650 12:65193788-65193810 AGGTATAAGCAGGGCAGGAGAGG - Intronic
1098271266 12:68772326-68772348 AAGGTCAAACAGGCCAGGCGTGG - Exonic
1098787760 12:74781259-74781281 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1099185277 12:79509788-79509810 AGGGCCAAGGAGGCCGGGACAGG + Intergenic
1099223963 12:79946545-79946567 AATGGAAAGCTGGCCAGGAGCGG - Intergenic
1099266929 12:80459394-80459416 AGTGTCAAGCATGCCAGAAGTGG + Exonic
1100017249 12:90025481-90025503 AGAGAGAAGCAGGCCGGGAGCGG - Intergenic
1100256269 12:92886470-92886492 AGGGGAAAGGAGGGGAGGAGAGG + Intronic
1100591617 12:96035310-96035332 AGGGGCAGGGAGCCCGGGAGAGG + Intronic
1100999948 12:100347234-100347256 AGGTAGAAGCAGGCCAGGCGCGG - Intergenic
1101007538 12:100415718-100415740 AGTGGCAAGAAGGCCAGGTGTGG - Intronic
1101960801 12:109248403-109248425 AGGAGCAAGGAAGCCAGTAGTGG + Intronic
1102002038 12:109563432-109563454 AGCGGCTACCAGGCCAGGCGGGG + Intronic
1102039802 12:109793632-109793654 TGGGGCCAGCAGGAGAGGAGAGG + Intronic
1102268469 12:111508289-111508311 AGGGGGAAGCAGCTGAGGAGGGG + Intronic
1102331214 12:112032591-112032613 AGGGGCAAGAAGGACAGTGGTGG - Intronic
1102406915 12:112681261-112681283 AAGGGCAGTCAGGCCTGGAGAGG - Intronic
1102423567 12:112823158-112823180 AGGGGCCAGAGGGCCAGGAATGG + Intronic
1102863853 12:116359049-116359071 CTGGGCAGGAAGGCCAGGAGTGG + Intergenic
1104073707 12:125370945-125370967 AGGAGCAAGGAAGCCAGTAGTGG + Intronic
1104185058 12:126422631-126422653 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1104517759 12:129443531-129443553 AGGGACAACAAGTCCAGGAGTGG - Intronic
1104563527 12:129859868-129859890 AGGAGCAAGGAAGCCAGTAGTGG - Intronic
1105955965 13:25282894-25282916 AGGGACAAGCAGGCCGGGCATGG - Intronic
1106137302 13:26983328-26983350 AGGGCCAAGCAGGCCAAGTTAGG - Intergenic
1106504005 13:30355684-30355706 GGGAGAAAGGAGGCCAGGAGAGG - Intergenic
1106843064 13:33707542-33707564 AGGTGCCAGAAGGCCAGGTGTGG - Intergenic
1107009522 13:35654269-35654291 AAGGGCTAGCAGGGGAGGAGAGG - Intronic
1107035037 13:35893188-35893210 CGGGGCAAGGAGTCCAGCAGAGG + Intronic
1107655559 13:42589391-42589413 AGTGGCAGTGAGGCCAGGAGGGG - Intronic
1107860333 13:44654681-44654703 AGAGGAATGCAGGCCAGGCGCGG + Intergenic
1108165660 13:47690385-47690407 AGGGGCAAGGGGGCTGGGAGAGG - Intergenic
1108287437 13:48922561-48922583 AGGGGTGGGCAAGCCAGGAGGGG - Intergenic
1108304065 13:49113241-49113263 AGGGGGAAGCAAGCAAGGAGAGG - Intronic
1108352003 13:49596341-49596363 AAGGGCCAGCAGGCAAGGAAAGG + Intergenic
1108500660 13:51066946-51066968 AAGGGCAGGCAGGATAGGAGAGG - Intergenic
1108941591 13:55962882-55962904 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1109192363 13:59340934-59340956 AGCTGCAAGTAGGCCAGGCGTGG + Intergenic
1110065614 13:71101676-71101698 AGGAGCAAGGAAGCCAGCAGTGG - Intergenic
1111182441 13:84686768-84686790 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1111703331 13:91717843-91717865 ATGTGCAAGCAGGCCAGGCGCGG - Intronic
1111811681 13:93099275-93099297 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1112142527 13:96661141-96661163 AGGAGCAAGGAAGCCAGTAGTGG - Intronic
1112253580 13:97806896-97806918 AGGTGCAAACTGGCCAGGTGTGG + Intergenic
1112323443 13:98427708-98427730 AGGAGAAAGAACGCCAGGAGCGG - Intronic
1112439761 13:99417073-99417095 ATGTGCAAGGAGGCCAGCAGAGG + Intergenic
1112968541 13:105230042-105230064 AGGAGCAGGCAGGCCAGGCACGG - Intergenic
1113042504 13:106120166-106120188 AGGAGCAGGCAGGCCAGGCGGGG - Intergenic
1113128988 13:107013582-107013604 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1113218668 13:108072768-108072790 AGGAGCAAGGAAGCCAGTAGCGG + Intergenic
1113755541 13:112808493-112808515 AGGGACAAGGAGGTCAGTAGTGG - Intronic
1114525788 14:23366220-23366242 AGGGGCCAGGAGCCCAGGAAGGG - Intergenic
1115391683 14:32861196-32861218 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1116075059 14:40100825-40100847 AGGGGAAGGGAGGGCAGGAGAGG - Intergenic
1116075067 14:40100845-40100867 AGGGGAAGGGAGGGCAGGAGAGG - Intergenic
1116628454 14:47297516-47297538 AGGGGCAGGGAGGTTAGGAGGGG + Intronic
1118312015 14:64700852-64700874 AGAAACAACCAGGCCAGGAGTGG - Intergenic
1118947949 14:70406146-70406168 AGGCATAAGCAGGGCAGGAGGGG + Intronic
1119478299 14:74944390-74944412 ATGAACAAGCAGGCCAGGCGCGG - Intronic
1119719433 14:76881340-76881362 AGGGGCTGCCAGGCCAGTAGGGG - Intergenic
1119949553 14:78730343-78730365 AAAGGTAAGCAGGACAGGAGAGG - Intronic
1120163253 14:81168118-81168140 AGGTGCAAGGAGGGCAGGAGAGG - Intergenic
1120424517 14:84330136-84330158 AAGGGCAAGGAGGCCAGGTGTGG + Intergenic
1120786222 14:88539536-88539558 AAGGGAAAGAAGGCCAGGCGTGG - Intronic
1121039545 14:90734126-90734148 AGGAGGAAACAGGCCAGGCGTGG + Intronic
1121098361 14:91233485-91233507 AGGGGGAAGGAAGGCAGGAGGGG - Exonic
1121819214 14:96952759-96952781 AAAGACAAGCAGGCCAGGCGTGG + Intergenic
1121868379 14:97384175-97384197 GGAGGCAGGCAGGCCAGGATTGG - Intergenic
1122094554 14:99361660-99361682 AGAGGCAAACAGGCATGGAGAGG - Intergenic
1122115010 14:99523214-99523236 AGGGGCAAGGAAGGCAGGACAGG + Intronic
1122651779 14:103230411-103230433 GGGTGCAAGCAGGTCAGGACAGG + Intergenic
1122791121 14:104184633-104184655 AGCGACCAGCAGGCCAGGAGGGG - Intergenic
1122861384 14:104584176-104584198 ATGGGGAAACAGGCCTGGAGAGG - Intronic
1122886052 14:104710910-104710932 AGGGGCAGCCAGGGCTGGAGAGG - Intronic
1122890312 14:104729207-104729229 AGTGGCAAGTGGGCCGGGAGTGG + Intronic
1122977749 14:105177892-105177914 AGGAGCAAGCAGCCTGGGAGGGG + Intronic
1124466019 15:29940814-29940836 GGTGGCAAGCAGGCCAGAGGAGG - Intronic
1124624277 15:31299177-31299199 AGGGGAATGCAGGGAAGGAGGGG + Intergenic
1125675843 15:41502265-41502287 AGGGGCAGGCGGGGCGGGAGCGG - Intronic
1125691879 15:41602275-41602297 AGAGTCAACCAGGCCAGGAAAGG - Intergenic
1125859317 15:42983365-42983387 AAGGTCATGAAGGCCAGGAGTGG + Intronic
1126669172 15:51100888-51100910 AAGGACAGGCAGGCCAGGACTGG - Intronic
1127066782 15:55248317-55248339 AGGGACAGGAAAGCCAGGAGAGG - Intronic
1127427687 15:58872378-58872400 ATAGTCAAGCAGGCCAGGCGCGG + Intronic
1128738017 15:70064474-70064496 TGGGGAAAGAAGGCCAGGACAGG + Intronic
1128793157 15:70447902-70447924 AGGGGCAAGCAGGTCCAGGGAGG - Intergenic
1128874648 15:71192190-71192212 AAGGTCAAGAAGGCCAGGTGCGG - Intronic
1129063489 15:72880804-72880826 AGGGGAAAGCAGGGGAGGGGAGG + Intergenic
1129672644 15:77615833-77615855 GGCTGCCAGCAGGCCAGGAGGGG + Exonic
1129921792 15:79325642-79325664 AGGAGCAAGGAAGCCAGTAGAGG + Intronic
1129951728 15:79597855-79597877 AGGGGCAGTCAGGGCTGGAGGGG - Intergenic
1130059138 15:80557220-80557242 AGTGGGAAGAAAGCCAGGAGTGG - Intronic
1131051904 15:89353963-89353985 TGGGGGAAGCAGGCCAGGGAAGG + Intergenic
1131261939 15:90892121-90892143 AGCGACAAGGAGGCCAGCAGAGG - Intronic
1131431245 15:92390967-92390989 AGGGGTAAGCAGGAGGGGAGGGG + Intergenic
1131553453 15:93377270-93377292 AGGGGCAGGCAGTCCAGAAAGGG - Intergenic
1131614260 15:93997922-93997944 AGGGGCTAGCAGGTCATGCGTGG + Intergenic
1132145896 15:99429751-99429773 AGGGGGAAGCAGGGGAGGAGGGG + Intergenic
1132255687 15:100373881-100373903 GGGGGCGAGCAGGGAAGGAGGGG + Intergenic
1132303938 15:100794988-100795010 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1132782278 16:1634105-1634127 TGGGGGAAGCTGGCCAGCAGCGG + Intronic
1132872016 16:2119554-2119576 TGGGGAAACCAAGCCAGGAGAGG + Intronic
1132929145 16:2449801-2449823 GGAGGAAAGCAGGCCAGGGGTGG - Intronic
1133500022 16:6357105-6357127 ATCCGCAAGCAGGGCAGGAGGGG - Intronic
1133727343 16:8549911-8549933 AGGGGTAAGGAAGCCAGTAGTGG + Intergenic
1133851101 16:9504733-9504755 AGAGGCAGGCAGGTCAGGAGAGG - Intergenic
1134217955 16:12330923-12330945 GGGGGCTAGCATGCCTGGAGTGG - Intronic
1134485691 16:14656580-14656602 AGGAGGAAACAGGCAAGGAGAGG - Intronic
1134715397 16:16356026-16356048 TGGGGAAACCAAGCCAGGAGAGG - Intergenic
1134749208 16:16612468-16612490 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1134795543 16:17032331-17032353 AGGGTCACGCAGCCCAGAAGCGG - Intergenic
1134959360 16:18396133-18396155 TGGGGAAACCAAGCCAGGAGAGG + Intergenic
1134996262 16:18741175-18741197 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1135135039 16:19881136-19881158 AGTGGGAGGCAGGCCAGAAGAGG + Intronic
1135250921 16:20900467-20900489 AGGGGCAAGGAGGGAACGAGTGG + Intronic
1135527734 16:23226933-23226955 AGGAGCAAACAGGGCAGCAGGGG - Intergenic
1135559662 16:23466415-23466437 TGAGGCAAGCTGGACAGGAGAGG - Exonic
1136058873 16:27711124-27711146 ACTGCCACGCAGGCCAGGAGAGG + Intronic
1136345553 16:29673391-29673413 ATGGGGATGCAGGCCAGGTGCGG - Intronic
1136619987 16:31422228-31422250 ATGAGCAAGCTGGCCAGGCGAGG - Intronic
1137259328 16:46811211-46811233 AGAGAGAAGCAGGCCAGGCGCGG + Intronic
1137610533 16:49814363-49814385 GAGGGCAAGCAGGACAGGGGTGG + Intronic
1137868025 16:51921543-51921565 AGGGGCACACAGGCCTGGTGAGG + Intergenic
1137938634 16:52658970-52658992 GGGGGCATGCCTGCCAGGAGGGG - Intergenic
1138105548 16:54285685-54285707 AGAGGGGTGCAGGCCAGGAGGGG - Intronic
1138176154 16:54900072-54900094 AGGGTCCAGCAGCCTAGGAGAGG - Intergenic
1138331880 16:56221875-56221897 AGGGGAAACCAAGGCAGGAGGGG + Intronic
1138448414 16:57078806-57078828 AAGGGAATGAAGGCCAGGAGAGG + Intronic
1138452721 16:57103412-57103434 AGGGAAAAACAGGCCAGGTGTGG - Intronic
1138474955 16:57265124-57265146 CGCCGCAAGCAGGCCAGGTGAGG + Intronic
1139462712 16:67135434-67135456 AGGGGAGAGCTGGCCAGGTGCGG - Intronic
1140127970 16:72133635-72133657 AGGTGTGAGCAGGGCAGGAGAGG + Intronic
1140131586 16:72166593-72166615 AGGGGGAAGCAGGACAGGGAAGG + Intronic
1140658631 16:77165901-77165923 AGGAGCAAGGAAGCCAGCAGTGG + Intergenic
1140891379 16:79288113-79288135 AAGGGGAAGCAGGGGAGGAGTGG + Intergenic
1141085992 16:81096074-81096096 CGGGACAAGCAGCCCAGGCGGGG + Intronic
1141691369 16:85598639-85598661 CTGGGCAGGCAGGCCAAGAGGGG + Intergenic
1141809549 16:86365796-86365818 GAGGTGAAGCAGGCCAGGAGGGG + Intergenic
1141823595 16:86464036-86464058 TGGGGCAAGCTGCCCAGCAGTGG - Intergenic
1142121674 16:88389644-88389666 TGAGGCAACCAGGCCAGGGGAGG + Intergenic
1142154858 16:88528284-88528306 AGGAGCAGGCAGGGCAGGAGAGG + Intronic
1142155194 16:88529817-88529839 AGGGGCCAGCTGGCCAGAGGGGG + Intronic
1142332929 16:89467139-89467161 AGCTGCAATCAGGCCAGGAGCGG + Intronic
1142378343 16:89718170-89718192 AGGAGCAAACTGGCAAGGAGAGG - Intronic
1142485196 17:243126-243148 AGGGGCAATCAGTAGAGGAGGGG - Intronic
1142610672 17:1107970-1107992 AGGGGCAGGGAGGCCCAGAGAGG + Intronic
1143096517 17:4481209-4481231 AGGGGCAAGCAGGAGGAGAGAGG + Intronic
1143180960 17:4983872-4983894 AGGGGCACAGAGGCCAGGAGTGG - Intronic
1143453901 17:7053481-7053503 AGGGGCAGTCAGACCAGAAGGGG + Intergenic
1143461647 17:7108176-7108198 AGGGGCAGGCAGGTAAGGGGTGG - Intronic
1143479026 17:7218185-7218207 AGGGGCAGGCAGGGCTGGAGGGG - Intronic
1143496821 17:7317249-7317271 GGGGGAAAGCAGCACAGGAGGGG + Exonic
1143682865 17:8490633-8490655 AGTGGCCAGCATGCCACGAGTGG - Intronic
1144639844 17:16931250-16931272 CGGGGCAGGCAGGACAGTAGGGG - Intronic
1144667554 17:17112320-17112342 AGGGGCAAGGAGGCCGGGTTTGG - Intronic
1144749607 17:17639336-17639358 ATGGGGAAGCAGGCCATGGGTGG + Intergenic
1144788566 17:17845191-17845213 AGGTGCAAGCAGGCCACCTGAGG + Intronic
1144793261 17:17873739-17873761 AGGGAGAAGCAGGCCTGGAGAGG - Intronic
1145057718 17:19714329-19714351 AGGGGCCTGCAGTCCAGCAGGGG - Intronic
1145159557 17:20565335-20565357 AGGGGCAGCTGGGCCAGGAGTGG + Intergenic
1145783068 17:27576592-27576614 AGTGACAAACAGGCCGGGAGTGG + Intronic
1145942050 17:28747715-28747737 AGGGGCAAAGAGCCCAAGAGAGG + Intronic
1146308409 17:31748452-31748474 AGGGAGAAGAAGGCCAGGCGCGG + Intergenic
1146341549 17:32023411-32023433 AGGGTGAAGCGGGCCAGGCGCGG - Intronic
1146804040 17:35850962-35850984 GGAGGTAAGCAGGCCAGGCGCGG + Intronic
1146809872 17:35894535-35894557 AGGTGAAAGGAGGGCAGGAGAGG + Intergenic
1146972912 17:37086972-37086994 AGGGGCTGTCAGGACAGGAGGGG + Exonic
1147125412 17:38364656-38364678 AAGGGCAAGCAGGCGAGGCTGGG - Intronic
1147291956 17:39450920-39450942 AGGGGCATAGAGTCCAGGAGAGG - Intronic
1147293505 17:39462093-39462115 GGGGGCAAGAAGGACGGGAGTGG + Exonic
1147646542 17:42037837-42037859 AGGGGCAGGGAGGCCAGCAGGGG + Exonic
1147657449 17:42098776-42098798 AAGGGGACTCAGGCCAGGAGAGG - Intergenic
1147670942 17:42176426-42176448 AGGAGATAGAAGGCCAGGAGAGG + Intronic
1147685643 17:42285479-42285501 AGGGGCAAGGAGGCCAGCCTCGG + Intergenic
1148115197 17:45171381-45171403 AGGGGCAGGCAGGCCTCCAGAGG - Intergenic
1148131301 17:45264096-45264118 AGGGGTGAGCTGGCCAGGTGAGG + Exonic
1148226596 17:45902358-45902380 AGGTGCAAGCTGGCCGGGCGCGG - Intronic
1148458226 17:47822233-47822255 AGGGGCAGTCAAGCCAGGAAAGG + Intergenic
1148698057 17:49573005-49573027 AGGGGCTAGGAGGACAGGTGGGG - Intergenic
1148821358 17:50361612-50361634 AGGGGTAAACAGGCCCAGAGAGG + Intronic
1148872836 17:50668756-50668778 AGGGGAAAGGAGGACAGGGGAGG - Intronic
1148960417 17:51387919-51387941 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1149384213 17:56125857-56125879 AGGGGCAGACAGGCCGGCAGGGG + Intronic
1149468037 17:56894795-56894817 AGGGGCCAGGAGGCGAGGAAGGG + Intronic
1149515349 17:57276951-57276973 AGGGGAAAGGAGACCTGGAGAGG + Intronic
1149625081 17:58074364-58074386 AGGGGGCGGCTGGCCAGGAGGGG + Intergenic
1149639707 17:58194829-58194851 AGGGGCATGGAGGGCAGAAGAGG + Intronic
1149651269 17:58278070-58278092 CGGGGCAAGCCGGGCAGGAGCGG + Exonic
1149672215 17:58424628-58424650 AGGAGGAAGAAAGCCAGGAGTGG + Intronic
1149894978 17:60422299-60422321 AGCGCACAGCAGGCCAGGAGAGG - Intronic
1150764791 17:67994114-67994136 AGGGGAAGGGAAGCCAGGAGGGG + Intergenic
1151190865 17:72396820-72396842 AGGGGCAAGCAGGCCCTGGGAGG - Intergenic
1151192158 17:72406570-72406592 AGGTGTAAGGAGGGCAGGAGAGG - Intergenic
1151326752 17:73384393-73384415 AGGGACCAGCAGGCCTGGGGAGG - Intronic
1151430749 17:74060809-74060831 AGGCCTAAGCAGGGCAGGAGAGG + Intergenic
1151699034 17:75732794-75732816 ATGGGACAGCAGGCCAGGCGAGG + Intronic
1151837009 17:76588358-76588380 AGGGACAGGCAGCACAGGAGAGG - Intergenic
1152347319 17:79761022-79761044 AGGGACAGACAGGACAGGAGAGG + Intergenic
1152368837 17:79872507-79872529 AGGGGAAAGCAGGGGAGGGGAGG - Intergenic
1152368851 17:79872536-79872558 AGGGGAAAGCAGGGGAGGGGAGG - Intergenic
1152395303 17:80029295-80029317 AGGGGCGGGCAGGGGAGGAGAGG + Intronic
1152549662 17:81022887-81022909 AGGGGCCACCAGGGCAGGGGAGG + Intergenic
1152568554 17:81111245-81111267 AGCGCCCAGCAGGGCAGGAGAGG - Intronic
1152614557 17:81331765-81331787 AGGGGCAGGCAGGCTCTGAGAGG - Intergenic
1152794723 17:82301380-82301402 AGGGGTGAGCTGGGCAGGAGGGG + Intergenic
1152872502 17:82764352-82764374 AGGAGAAAGCAGGCCGGGTGCGG + Intronic
1152876565 17:82789859-82789881 CCGGGTAAACAGGCCAGGAGGGG - Intronic
1153398532 18:4654038-4654060 AGGATCAAGCAGGCCAGGCATGG + Intergenic
1153632539 18:7085706-7085728 AGGGTAAAATAGGCCAGGAGCGG - Intronic
1153771682 18:8421933-8421955 AGGGGAAAGCAGCCCAGGCCGGG + Intergenic
1153884216 18:9448673-9448695 AGGGGCAAACAGCCCTGCAGGGG - Intergenic
1153971160 18:10228556-10228578 AGTGGTTAGCAGGGCAGGAGGGG - Intergenic
1154965082 18:21348233-21348255 AGAGTCAAGCAAGCCAGGCGCGG - Intronic
1154966757 18:21366265-21366287 AGAGGAAAGCAGGGAAGGAGAGG - Intronic
1155293107 18:24360840-24360862 AGGGGGATCCAGGCCTGGAGAGG - Intronic
1155919013 18:31584445-31584467 TGGAACAAGCAGGTCAGGAGGGG - Intergenic
1157064512 18:44331884-44331906 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1157121247 18:44913275-44913297 AGGGGCAAGCATGTCAGGACTGG + Intronic
1157481724 18:48059569-48059591 AGGGGCAGGAGGGCCTGGAGAGG + Intronic
1158239499 18:55361013-55361035 AGGGGTTAGCAGGCCAGGTGTGG - Intronic
1158446524 18:57526866-57526888 AGGAGCAAGGAAGCCAGCAGTGG - Intergenic
1159269591 18:66131212-66131234 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1160304508 18:77719099-77719121 TGGGGTAAGCAGGCCAGGGATGG + Intergenic
1160812332 19:1018194-1018216 AGGGCCATGAAGGCCAGCAGAGG + Intronic
1161129628 19:2580201-2580223 AGGGGTGAGCAGGCCAGGCCGGG - Intronic
1161153932 19:2722656-2722678 AGGGGTCTGGAGGCCAGGAGGGG - Intronic
1161703125 19:5805459-5805481 AGGGGCAGGCGGGGCAGGTGGGG + Intergenic
1162323739 19:9986339-9986361 CGGGGCAGGCTGGCGAGGAGGGG - Exonic
1162414096 19:10524043-10524065 AAGGGGAAACAGGCCAGGTGTGG - Intergenic
1162450167 19:10749603-10749625 AGGGCCACACAGCCCAGGAGGGG + Intronic
1162565610 19:11444724-11444746 AGGGGCCAGCCGGACAGAAGGGG - Intronic
1162727875 19:12700889-12700911 AGGGAGGAGCAGGTCAGGAGGGG - Exonic
1162748416 19:12812714-12812736 AGCGGCAAGGAGGCCGGGCGTGG + Intronic
1163478956 19:17543239-17543261 AGGGGTCAGCTGGGCAGGAGTGG + Intronic
1163677115 19:18660693-18660715 AGGAGGGAGGAGGCCAGGAGGGG - Intronic
1164857215 19:31534418-31534440 AGAGCAAAGCAGGCCAGGTGAGG - Intergenic
1165870983 19:38973082-38973104 AAGGGCAACCTGGCCAGGCGTGG + Intronic
1166316627 19:41993160-41993182 AGGGGGAATCAGGAGAGGAGGGG - Intronic
1166913863 19:46180647-46180669 AGGAGCAAGGAAGCCAGCAGTGG + Intergenic
1167284559 19:48591744-48591766 AGGGTAAAGCGGGGCAGGAGGGG + Intronic
1167374878 19:49105438-49105460 TGGGGCAACCAGGCCAGGCGTGG + Intronic
1167474890 19:49694338-49694360 AGGGGGTGGCAGGCCAGGTGCGG + Intronic
1167611318 19:50509013-50509035 ATGGGCAGGCTGGGCAGGAGAGG + Intronic
1167767079 19:51490637-51490659 AAGGGCAAGCAGGTGAGGAGAGG + Exonic
1168278493 19:55290284-55290306 ATGGGCAAAGAGGCCGGGAGTGG - Intronic
1168288444 19:55345849-55345871 GGGGGCAGGCAGCTCAGGAGGGG + Intronic
1168309994 19:55455454-55455476 AGGGGCCCCCAGGTCAGGAGGGG + Intronic
1168510079 19:56967054-56967076 AGGGACGAGCATTCCAGGAGAGG + Intergenic
924972909 2:146242-146264 AGAAGCAACCAGGCCAGGCGTGG - Intergenic
925518049 2:4707027-4707049 AGAGGCAAGGAGGCAAGGAGAGG - Intergenic
925540018 2:4956784-4956806 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
925625883 2:5841902-5841924 GGGTGCAAGCAGGGAAGGAGGGG + Intergenic
925657419 2:6164880-6164902 AAAGGCAAGCAGGCCACCAGTGG + Intergenic
925737608 2:6978072-6978094 AGGGGCTAGTAGACCAGGAGAGG + Intronic
925743637 2:7027196-7027218 AGAGGGAAGCAGGGGAGGAGAGG - Intronic
925811350 2:7703847-7703869 AGGGGCCAGGAGGCCAGAGGGGG - Intergenic
925887058 2:8402120-8402142 TGTGGCAAGCTGGCCAGGTGAGG + Intergenic
926206624 2:10838464-10838486 AGGGGCCTGCAGGTGAGGAGTGG + Intergenic
926251357 2:11156958-11156980 AAGGGCATGAAAGCCAGGAGTGG + Intronic
927471479 2:23380889-23380911 AGGGGCCAGGAGGTCAGGGGAGG - Intergenic
927638401 2:24832031-24832053 AGGGGCCAGCAGACAAGGACCGG + Intronic
927679082 2:25128329-25128351 AGAGGTAAGCAGGCCGGGATGGG + Exonic
927702310 2:25276301-25276323 GTGGGAAAACAGGCCAGGAGAGG - Intronic
927826877 2:26315486-26315508 AGGAGAAAGGAGGCAAGGAGAGG + Intronic
928871876 2:35989860-35989882 AGGAGCAAGCAAGCCTGAAGAGG + Intergenic
929055578 2:37873502-37873524 GGGAGCAATCAGGCCAGAAGAGG + Intergenic
929117319 2:38455547-38455569 ATAGGAAAGCAGGCCAGGTGTGG - Intergenic
929444572 2:41992128-41992150 AGGGGCAAGAAGGGAAGGGGAGG + Intergenic
929544103 2:42844517-42844539 AGGGCAAAGCAGGCCGGGTGCGG - Intergenic
929574147 2:43041733-43041755 AGGGGCACGCTGGCAGGGAGGGG - Intergenic
929867875 2:45733845-45733867 AGGGGCCAGCAGGCCCCAAGTGG - Intronic
929916979 2:46144274-46144296 AGGGGCAAGCAGGCTGGGTGGGG - Intronic
930115447 2:47714313-47714335 AGGAGTAACCAGGCCAGGTGTGG + Intronic
930374086 2:50541989-50542011 AAGAACAAGCAGGCCAGGCGTGG + Intronic
930824318 2:55681114-55681136 AGGGAAAAACAGGCCAGGCGTGG + Intronic
930879710 2:56257449-56257471 AGGGGCAAGCATACGACGAGGGG + Intronic
931485143 2:62683368-62683390 ATGAGTAAGCAGGCCAGGCGCGG + Intronic
931629053 2:64283203-64283225 AGGGGAAGGCAGCCCAGGTGAGG + Intergenic
931692122 2:64844178-64844200 AGAGGCGAGCAGTCCAGGACTGG + Intergenic
931707856 2:64962368-64962390 AGGAGCAAGGAAGCCAGCAGTGG + Intergenic
931757272 2:65385260-65385282 AGTGGAAAGCAGGCCGGGCGTGG - Intronic
932237223 2:70130189-70130211 AGGAGCAAGCAGGCTGGGCGTGG + Intergenic
932413442 2:71560359-71560381 GGGGGCAAGCGGGTCTGGAGAGG - Intronic
932470286 2:71950723-71950745 AGGGGCAACTTGGCAAGGAGAGG - Intergenic
932920305 2:75906128-75906150 AGAGGCAAGGAAGCCAGTAGTGG - Intergenic
933087341 2:78072242-78072264 AAGGAAAAGCAGGCCAGGCGCGG + Intergenic
933228851 2:79782525-79782547 GAAGGCAAGCAGGCCAGGTGCGG - Intronic
933704804 2:85281725-85281747 TGGGCCAAGCAGGCCTGGCGCGG - Intronic
934111469 2:88747386-88747408 AGGTGCAGGCAGGCAGGGAGGGG - Intronic
934775874 2:96937184-96937206 ATGTGCAAACAGGCCAGGTGTGG - Intronic
934884414 2:98012056-98012078 AGGAGCAGGAAGGCCAGGCGCGG + Intergenic
934907392 2:98217128-98217150 AGGGGGCAGGAGGACAGGAGTGG - Intronic
935238722 2:101159891-101159913 AGAGGCAAGCACCCCAGGAAAGG + Intronic
935580268 2:104750321-104750343 AGGGGCAAGGGGGCTGGGAGGGG + Intergenic
936285431 2:111177778-111177800 AGTGGCAAACAGGCCAGGCGCGG - Intergenic
936401623 2:112168979-112169001 AACAGCAGGCAGGCCAGGAGCGG + Intronic
937799903 2:126071216-126071238 AGGAGCAAGGAGGCCAGTAGTGG - Intergenic
937878973 2:126850874-126850896 ATGAGGAAGCAGGCCTGGAGAGG + Intergenic
937910625 2:127073884-127073906 AGGGGCAAGCAGGCCCCCATGGG + Intronic
938259100 2:129882628-129882650 AGGGGCCATCAGGCTTGGAGAGG - Intergenic
939057946 2:137385357-137385379 AGGGGCATGGAGGCCAGGGCAGG - Intronic
942147248 2:173039165-173039187 AAGTTCAAGCAGGCCAGGTGTGG + Intronic
942428447 2:175883943-175883965 TGGGGCAAGCAGGTGAGGGGAGG + Intergenic
942982099 2:182094998-182095020 AGTGGCATGTTGGCCAGGAGCGG + Intronic
943120187 2:183725606-183725628 AGAAGCAAGCAGGCCAGGCATGG + Intergenic
943734436 2:191339073-191339095 ATGAGAAAGCAGGCCTGGAGGGG + Intronic
944076929 2:195743258-195743280 AGGAGCAAGGAAGCCAGTAGTGG - Intronic
944686987 2:202126241-202126263 AGCAGCCAGGAGGCCAGGAGTGG - Intronic
945146019 2:206739123-206739145 AGTGGGAAGCAGGCCAGGCACGG + Intronic
946057282 2:216913309-216913331 AGGGGCAAGGTGGCCAGGTGCGG + Intergenic
946336109 2:219037701-219037723 AAGGGCAAACAGGCCCGGAATGG + Intronic
947147498 2:227081550-227081572 AGGAGCAAGGAAGCCAGTAGTGG - Intronic
947505422 2:230704796-230704818 AAGGAAAAGCAGGCCAGGCGCGG - Intergenic
947653022 2:231803261-231803283 AGGGGCAACCTGGGGAGGAGCGG + Intronic
947998344 2:234547302-234547324 AGAGGCAAGCAGGAAGGGAGTGG + Intergenic
948080976 2:235204922-235204944 ATGAGGAAGAAGGCCAGGAGAGG - Intergenic
948126701 2:235569358-235569380 AGGGGACACCTGGCCAGGAGAGG - Intronic
948256364 2:236571341-236571363 AGGGGAAAGCTGCCCAGGATGGG + Intronic
948383442 2:237567119-237567141 AGGGGGAAGCAGGTCAGCCGGGG - Exonic
948567192 2:238894595-238894617 AGCGACAAGGAGGCCAGGAAAGG - Intronic
948782305 2:240329406-240329428 GGAGGCAGCCAGGCCAGGAGAGG + Intergenic
948973961 2:241451262-241451284 AGCGGCAAATTGGCCAGGAGTGG - Intronic
949066853 2:241996254-241996276 TGTGACAAGCAGGCCAGGACAGG - Intergenic
1168856500 20:1012892-1012914 GGAGGGAAGCAGGGCAGGAGTGG + Intergenic
1169042483 20:2507974-2507996 AGGGAAAAGCAGTCCAGGAAAGG + Intronic
1169092560 20:2870656-2870678 AGGGGAAAGGAGGCCCCGAGAGG + Intronic
1169119421 20:3085950-3085972 GGGGGCCAGCAACCCAGGAGGGG + Intergenic
1169122716 20:3107003-3107025 CGGGGGAAGCAGGGCAGGTGTGG + Intergenic
1170120062 20:12901762-12901784 AGGTGAAGGCAGGCCAGGTGTGG - Intergenic
1170331175 20:15212560-15212582 AGGGCAAGGCAAGCCAGGAGAGG + Intronic
1170368605 20:15624008-15624030 AGGAACAAGGAAGCCAGGAGTGG + Intronic
1170439939 20:16368788-16368810 GGAGGCAAGCAGGCCAGGCAAGG - Intronic
1170588356 20:17752534-17752556 AGGAGGAAGCAGGCAAGGTGAGG + Intergenic
1170703940 20:18728127-18728149 GGAGGCAGGAAGGCCAGGAGGGG - Intronic
1170850389 20:19998962-19998984 AGGGTCAATGAGGGCAGGAGGGG - Intronic
1171167551 20:22985286-22985308 AGGGGCAGGCAGCCCTGTAGAGG + Intergenic
1171248827 20:23633830-23633852 AGGGGCCACCAGTCCAGGGGTGG + Intronic
1171472735 20:25385045-25385067 AGGAAAAAGCAGGCCAGGCGCGG + Intronic
1171767226 20:29296950-29296972 AGGGGCAGGCACAGCAGGAGAGG + Intergenic
1172023706 20:31933927-31933949 AGTGGCAAGGAGCCCAGGACAGG + Intronic
1172785597 20:37466328-37466350 ATGGGGAAGCAGGACAGGAAAGG - Intergenic
1173190386 20:40871392-40871414 AGGGGCCAGATAGCCAGGAGAGG - Intergenic
1173556823 20:43972380-43972402 GGAGGCAAGCCGGACAGGAGTGG - Intronic
1173932958 20:46837076-46837098 AGTGGTAAGAAGGCCAGGATTGG + Intergenic
1174075985 20:47937406-47937428 GGAGGGAAGGAGGCCAGGAGGGG - Intergenic
1174736923 20:52973379-52973401 AGGGGCAAGGAGGGCGGGCGAGG - Intronic
1174826191 20:53770872-53770894 AGAGCCAGGCAGGCCAGGCGCGG - Intergenic
1175203680 20:57294837-57294859 AGGTGCAGGCAGACAAGGAGTGG + Intergenic
1176038067 20:63049976-63049998 AAGGGCCGCCAGGCCAGGAGGGG - Intergenic
1176138710 20:63536026-63536048 AGGGGGCGGGAGGCCAGGAGAGG - Intronic
1176138720 20:63536049-63536071 AGGGGACGGGAGGCCAGGAGAGG - Intronic
1176512458 21:7759065-7759087 AGGAGCAAACAGGTGAGGAGAGG - Intronic
1177842136 21:26246425-26246447 AAGGGAAATCAGGCCAGGTGCGG + Intergenic
1178056274 21:28802435-28802457 AATGGCAAACAGGCCAGGTGTGG + Intergenic
1178646570 21:34389589-34389611 AGGAGCAAACAGGTGAGGAGAGG - Intronic
1178934479 21:36849948-36849970 AAGTACAAGGAGGCCAGGAGAGG - Intronic
1179095561 21:38311535-38311557 AGGGGCAAATAGGAGAGGAGTGG + Intergenic
1179629162 21:42666085-42666107 AGGGGAAAGCAGCCCTGGGGTGG + Intronic
1179914311 21:44466671-44466693 AGGGCCACGCTGGCTAGGAGCGG + Intergenic
1179933268 21:44586093-44586115 AGAGCCAGGCAGGCCAGGGGTGG - Intronic
1179952469 21:44716940-44716962 AAAGGGAAGCAGGCCAGGCGTGG - Intergenic
1180203215 21:46239825-46239847 AGGAACCAGCAGGGCAGGAGGGG + Intronic
1180536432 22:16396646-16396668 AGGGGGAAGGATGCCAGGTGTGG + Intergenic
1181041364 22:20194183-20194205 AGTGCCCAGCAGGCCAGGGGCGG - Intergenic
1181288986 22:21776072-21776094 AGGGCCAGGCTGGCCAGGCGCGG - Intronic
1181337696 22:22153192-22153214 AGTGGAAAGGAGGCCAGGCGCGG + Intergenic
1181480528 22:23196292-23196314 AGGAGCCAGCAGGCCAGGGTGGG + Intronic
1181720221 22:24768540-24768562 AAGGGAAAACAGGCCAGGCGTGG - Intronic
1182236362 22:28880031-28880053 AGGGGAAGGCAGGCCAAGGGAGG + Intergenic
1182606482 22:31509295-31509317 AGGAGCAAGGAAGCCAGCAGTGG + Intronic
1182686748 22:32126662-32126684 AGAGGGAAGTAGGCCAGGTGCGG + Intergenic
1182776084 22:32831950-32831972 AGGGGCAGGCAGGGCAGGCGTGG + Intronic
1182963500 22:34499459-34499481 AGGGGCTAGCAGGGCAGGAGTGG + Intergenic
1183206060 22:36419780-36419802 AGAGACCAGCAGGCCAGGTGCGG + Intergenic
1183255347 22:36758172-36758194 AGGGCCACCCAGGCCAAGAGTGG + Intergenic
1183428609 22:37752520-37752542 AGGCGCATGCAGGGCAGGGGTGG - Intronic
1183447123 22:37864827-37864849 ATGGGCCAGTAGGCCAGGCGCGG - Intronic
1183506828 22:38214105-38214127 ATGGGGAAGGAGGCCTGGAGAGG - Intronic
1183511046 22:38235164-38235186 AGGCTCAGGCAGGGCAGGAGGGG + Intronic
1183604841 22:38862304-38862326 AGGGGCTAGAACTCCAGGAGAGG - Exonic
1183643624 22:39108967-39108989 AGGGGGAAACTGGCCAGGAGTGG + Intergenic
1183736675 22:39648397-39648419 GGGGGCAAGAGTGCCAGGAGAGG - Intronic
1183743697 22:39681617-39681639 GGAGGCCTGCAGGCCAGGAGGGG + Intronic
1183931921 22:41240373-41240395 AGGGGCCAGCTGGGCAGGGGAGG - Intronic
1184167247 22:42737124-42737146 AAGGGAAAACTGGCCAGGAGTGG - Intergenic
1184667655 22:45997174-45997196 AGAGGCAGGCAGGCCACGGGAGG + Intergenic
1184710012 22:46244267-46244289 GGGGGCAAGCAGGCAAGCAGTGG + Exonic
1184769273 22:46588275-46588297 AGGAGCCAGTAGGTCAGGAGGGG + Intronic
1185020658 22:48372842-48372864 TGGGACACGCAGGCCAGGAGCGG - Intergenic
1185088381 22:48752848-48752870 TGGGGCAGCCTGGCCAGGAGAGG + Intronic
1185284476 22:49994172-49994194 AGGGGCAGGGAGGCCAGTGGGGG - Intergenic
1185367425 22:50443340-50443362 AGGGGCACTCAGGTCAGGCGGGG - Intronic
949157637 3:848147-848169 AGTGGCAATCAGCCCAGGTGGGG - Intergenic
949230865 3:1748989-1749011 ATGGGTTAGCAGGCCAGGTGTGG + Intergenic
949482213 3:4504571-4504593 TGGGACAAGAAGGCAAGGAGGGG + Intronic
949519029 3:4832871-4832893 AGGGGCAGAGATGCCAGGAGCGG + Intronic
950449616 3:13058352-13058374 AGGGGCATGAAGGTTAGGAGAGG + Intronic
950486283 3:13275790-13275812 AAGGACAAGCAGCCCAGGAAGGG + Intergenic
950518722 3:13483604-13483626 AGGGGGCTGCTGGCCAGGAGTGG + Intronic
950639378 3:14338865-14338887 AGGGGCACGCTGCCCAGGTGAGG - Intergenic
950883655 3:16344480-16344502 AGGGGGAAGAAGGCCAGGGCAGG - Intronic
951529030 3:23681659-23681681 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
951543827 3:23806610-23806632 AGAGGCAGGCAGGCCGGGAGGGG + Intronic
951557926 3:23939450-23939472 ATGGGAAACCAGGCCAGGAACGG + Intronic
951804147 3:26626093-26626115 AGGGGCTCACAGGCCAGGACTGG - Intronic
951918515 3:27827281-27827303 AGGGGTAATCAAGCCAAGAGTGG - Intergenic
952985057 3:38771543-38771565 AGGGGGAAGAAGGTAAGGAGAGG + Intronic
953547203 3:43872375-43872397 AGGGGGCAGCAGCCCAGGTGGGG - Intergenic
954082334 3:48219933-48219955 AGGGGCAAGCAGGCCTGAGGAGG + Intergenic
954201530 3:49026110-49026132 AGGAGCAAGAAGGCCAGGCTAGG + Intronic
954379764 3:50213276-50213298 AGGGGCCCGCTGTCCAGGAGTGG - Intronic
954435798 3:50495294-50495316 AGGAGCCTACAGGCCAGGAGGGG - Intronic
954571135 3:51641823-51641845 AGGGGCAAGGAGCACAGAAGTGG + Exonic
954698459 3:52439787-52439809 AGGGGTCAGCGGGACAGGAGGGG + Intronic
955032248 3:55232691-55232713 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
955299917 3:57768426-57768448 AAAGTCAAGCAGGCCAGGTGTGG + Intronic
955706178 3:61730137-61730159 ACAGGCAAGCTGCCCAGGAGTGG - Intronic
955993754 3:64656761-64656783 AGGGGCACGGAGGCCAGGCAGGG + Intronic
956086461 3:65616220-65616242 AGGTGTAAGCAGGCAAGGGGTGG + Intronic
956609955 3:71112466-71112488 AGTGACAAGCAGTTCAGGAGTGG - Intronic
956652845 3:71521239-71521261 AGGGGCCAGGAGGCCGGGCGTGG + Intronic
956667141 3:71652592-71652614 ATGGGAAAGCAGGGAAGGAGAGG + Intergenic
956989953 3:74751634-74751656 AGCGGAGAGCAGGCCTGGAGTGG + Intergenic
957099043 3:75805851-75805873 AAGAACAAGCAGGCCAGGCGCGG - Intergenic
957743386 3:84304585-84304607 AGGGGCAATTAAGCCAGTAGTGG - Intergenic
957851892 3:85818983-85819005 AGGAGCAAGGAAGCCAGTAGTGG + Intronic
957861611 3:85959257-85959279 AGATGGAAGCATGCCAGGAGAGG - Intronic
958603690 3:96331515-96331537 AGGCATAAGTAGGCCAGGAGAGG + Intergenic
960351668 3:116601209-116601231 AGGGCCAAGTAGACCAGAAGTGG - Intronic
960664972 3:120099838-120099860 ATGGGCAACCAGGCCAGGTGCGG - Intergenic
960687218 3:120306807-120306829 GGGGGCTGGCTGGCCAGGAGCGG - Intergenic
961005951 3:123405494-123405516 AGGAGGGAGCAGGACAGGAGGGG + Intronic
961171849 3:124802739-124802761 CAGGCCATGCAGGCCAGGAGAGG - Intronic
961420202 3:126797050-126797072 AGGGGTAAGAAGGCCAGATGCGG - Intronic
961453923 3:127015097-127015119 GGGGGTAAGCAGGCCAAGTGGGG + Intronic
961855420 3:129865439-129865461 AAGTGCAAGGATGCCAGGAGTGG - Intronic
961926778 3:130489792-130489814 AAGAGCCAGGAGGCCAGGAGAGG - Intergenic
961951211 3:130751320-130751342 TGGAGTAAGCAGCCCAGGAGAGG - Intergenic
962525780 3:136236381-136236403 AGGGGAAAGAACGGCAGGAGGGG - Intergenic
962929292 3:140022434-140022456 GGAGGCAAGCTGCCCAGGAGAGG + Intronic
963041323 3:141072060-141072082 AGGGGCGACCAGGCCCAGAGGGG - Intronic
963488832 3:145972805-145972827 AGGAGCAAGGAAGCCAGGAGTGG - Intergenic
965071345 3:163918436-163918458 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
966735007 3:183181109-183181131 AGGGGCAGACAGGACTGGAGAGG + Intronic
967043411 3:185715059-185715081 AGGGGCAAGACAGACAGGAGGGG + Intronic
967048947 3:185764435-185764457 AGGGGCAAGCAGAACCTGAGGGG + Intronic
967088556 3:186115645-186115667 AGGGGCTGGCAGGGCTGGAGCGG + Intronic
967168592 3:186806228-186806250 AGGGGCATCAAGGGCAGGAGTGG + Intronic
968450349 4:673171-673193 ATGGGGAAGCTGGCCAGGCGTGG - Intronic
968509857 4:990861-990883 GGGGACCAGCAGGCCAGGTGTGG - Intronic
968551623 4:1226356-1226378 AGGGGGCAGGAGGCCAGGACAGG + Intronic
968579833 4:1384784-1384806 ACGGTCATGCTGGCCAGGAGGGG - Intronic
968876265 4:3269393-3269415 AGGAGGAAGGAGGCCAGGAGTGG + Intronic
968901065 4:3432065-3432087 AGGGGGACTCAGGCCAGGGGTGG - Intronic
968914573 4:3491825-3491847 AGGGGCTGGCAGAGCAGGAGGGG + Intronic
969143881 4:5102942-5102964 AGGGGCAAAAAGGAGAGGAGGGG - Intronic
969144848 4:5113703-5113725 AGGCGGAAGCAGACCATGAGGGG - Intronic
969326327 4:6446413-6446435 AGGGGCAGCCAGGCCACGGGGGG + Intronic
969370590 4:6728752-6728774 CAGGGCAAGCAGGGCAGGACAGG - Intergenic
969535697 4:7755089-7755111 GGTGGCAAGGAGGCCAGCAGGGG + Intergenic
970878138 4:20896508-20896530 AGAGGGAAGCAGGCCATGTGAGG + Intronic
971325326 4:25638730-25638752 AGGGGGAAGCAGGCCAGGTGCGG + Intergenic
971532275 4:27704225-27704247 AGGAGCAAGAAAGCCAGTAGTGG + Intergenic
971673067 4:29589538-29589560 AGGATCAAGCAGGCCAGGTGTGG + Intergenic
972022391 4:34332283-34332305 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
972150543 4:36084135-36084157 AGGAGCAAGGAAGCCAGTAGTGG - Intronic
972362907 4:38345406-38345428 AGGGGCATGGAGGGCAGGACAGG - Intergenic
972783746 4:42308531-42308553 AGGGACATCCAGGCCAGGACTGG - Intergenic
972788321 4:42347295-42347317 AGGGGCAGCCAGGCCCGGAGTGG - Intergenic
973639072 4:52885636-52885658 ATGGGCAGGCAGGCTAGGAGAGG + Intronic
975060256 4:69988444-69988466 AGGGGCAAGGAAGCCAGCAGTGG + Intergenic
975582259 4:75917754-75917776 AAGTGAAAGCAGGCCAGGTGCGG - Intronic
975724181 4:77276090-77276112 TGGGGCATGCAGGCCTGGATGGG + Intronic
975756988 4:77580774-77580796 AGGGGAGAGGAGGGCAGGAGAGG - Intronic
976030644 4:80749517-80749539 AGGAGCAAGGAAGCCAGTAGTGG + Intronic
976766755 4:88606011-88606033 AGGGGCAACTGGGCCATGAGAGG + Exonic
978603332 4:110451035-110451057 AGTGGTGAGCAGGCCAGGCGTGG - Intronic
979095460 4:116544271-116544293 AGGGGCCATCAGGACAGGAGTGG + Intergenic
979138895 4:117147568-117147590 AGGAGCCAGCAAGCCAGTAGTGG - Intergenic
979883134 4:125987658-125987680 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
980385471 4:132084315-132084337 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
980792178 4:137633666-137633688 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
981427146 4:144616580-144616602 AGGGCCAACCAGCCCCGGAGGGG + Intergenic
982222539 4:153137315-153137337 AGTGAGAAGCATGCCAGGAGAGG - Intergenic
984094338 4:175414958-175414980 AGAGCCCTGCAGGCCAGGAGAGG + Intergenic
984675737 4:182545512-182545534 AGGGTCTAGTAGGCCAGGAGAGG - Intronic
984681759 4:182619135-182619157 AGGAGCTAGAAGGCCAGGTGTGG + Intronic
985254976 4:188061077-188061099 ATGAGCATGCAGGGCAGGAGAGG + Intergenic
985499886 5:236312-236334 AGAGGGAAGTAGGCCAGGCGTGG - Intronic
985524710 5:396096-396118 GGGGGCCTGCAGCCCAGGAGCGG + Intronic
985547111 5:515289-515311 AGGGGCGGGCAGAGCAGGAGGGG - Intronic
985588179 5:751475-751497 GGGGGCATGCAGGGCAGGTGGGG + Intronic
985588205 5:751545-751567 GGGGGCATGCAGGGCAGGTGGGG + Intronic
985602849 5:843938-843960 GGGGGCATGCAGGGCAGGTGGGG + Intronic
985602873 5:844008-844030 GGGGGCATGCAGGGCAGGTGTGG + Intronic
985703257 5:1386221-1386243 AGAGGCCAGCAGGGCAGAAGGGG - Intergenic
985963571 5:3322213-3322235 AGCTGTGAGCAGGCCAGGAGTGG + Intergenic
986068167 5:4256203-4256225 ATGGACAAACAGGCCAAGAGTGG - Intergenic
986762934 5:10896629-10896651 AGGGACAAGCAGCCCAGAAGGGG + Intergenic
987045267 5:14101864-14101886 AGGGTCTGGCAGGCCAGGCGTGG - Intergenic
987878471 5:23711215-23711237 AGGGGTGAGCAGGACGGGAGAGG - Intergenic
988305979 5:29494675-29494697 AAGGGCAATCAGGCCAGGTGGGG - Intergenic
988415463 5:30941493-30941515 AGGGGGCAGAAGGTCAGGAGAGG + Intergenic
988421919 5:31016262-31016284 AATGGCAAGCAGGCCAGTATAGG + Intergenic
988679327 5:33469317-33469339 AGGAGCAAGGAAGCCAGTAGTGG - Intronic
988965780 5:36416366-36416388 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
989824708 5:45839199-45839221 AAGGTCAAGCAGGACAGTAGAGG - Intergenic
990149470 5:52800301-52800323 ATGGGAATGCAGGCCAGGAAGGG - Exonic
990695474 5:58411822-58411844 AGAGGCAGGCAGCCCAGGATTGG + Intergenic
990872229 5:60444701-60444723 AATTGCAAGCAGTCCAGGAGGGG + Intronic
991050747 5:62270701-62270723 AGGGGCACTCTGGCCAGGCGCGG - Intergenic
991960451 5:72039094-72039116 AGGGGGAGGCAGGCCAGGTAGGG - Intergenic
992023621 5:72649618-72649640 CAGGGCAAGCAAGGCAGGAGAGG + Intergenic
992272830 5:75083431-75083453 AGGGGAAAGCAGGCCAGGCCAGG + Intronic
993407027 5:87524648-87524670 AGGCACAAGCAGGGCAGAAGAGG - Intergenic
994549563 5:101213429-101213451 AGGAGCAAGGAAGCCAGTAGAGG - Intergenic
994774062 5:104022039-104022061 ACAGGCAAGCAGGCCAGGCATGG - Intergenic
995187132 5:109283315-109283337 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
995761573 5:115567307-115567329 AGGAGTAAGGAGGGCAGGAGGGG + Intergenic
996036021 5:118759672-118759694 AGGAGCAAGGAAGCCAGGGGTGG + Intergenic
996399733 5:123048713-123048735 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
997083015 5:130763187-130763209 AGGGGGAAGCTGGCCGGGTGTGG - Intergenic
997328286 5:133040361-133040383 AAGGTCAAGCAAGCCAGGCGCGG + Intergenic
997354183 5:133251842-133251864 AGGGGCATGGAGGCCAGTGGTGG + Intronic
997647981 5:135493751-135493773 AGGCCCAAGCAGGCCAGGGCAGG + Intergenic
998074738 5:139226360-139226382 AGGCATAAGCAGGGCAGGAGAGG - Intronic
998160056 5:139808265-139808287 AGGGGCAGACAGGGGAGGAGGGG + Intronic
998223414 5:140306679-140306701 TGGGGCTATCAGGCCAGGCGTGG + Intergenic
998380562 5:141722092-141722114 ATGGAAAAGCAGGCCAGGTGTGG - Intergenic
1000217462 5:159175595-159175617 ATGGGGAAGCAGGGCAGGAAGGG - Intronic
1000223718 5:159238018-159238040 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1000567356 5:162866474-162866496 AGGGGCATGGAGGTGAGGAGTGG + Intergenic
1000665731 5:163993840-163993862 AGGTTAAAGCAGGCCAGGTGGGG + Intergenic
1000902066 5:166923227-166923249 ACGGGGAAGCAGGCCGGGTGCGG + Intergenic
1001529823 5:172454155-172454177 AGGGGAGAGCAGGGGAGGAGGGG + Intronic
1002057868 5:176609229-176609251 AGGGGTGAGCAGGCCAGGGCAGG + Intronic
1002168617 5:177362990-177363012 AGGGCCAAGCAGCCCAGCGGAGG + Intronic
1002190019 5:177473250-177473272 AGGGGCCGGCGGGCCAGGCGGGG - Intronic
1002191386 5:177479576-177479598 AGGGGCAAGGAAGCCTGGACAGG - Intergenic
1002599201 5:180344764-180344786 AGGGGCAAGAAGGCCTGGCCAGG - Intronic
1002607237 5:180390561-180390583 GGGGGCAGGCAGGCCAGGGATGG - Intergenic
1002639056 5:180622016-180622038 GGGGGCAAGCAGTCCAGCTGGGG - Intronic
1003528319 6:6916897-6916919 AGGGGCTCTCAGGCCAGGAGGGG - Intergenic
1003823330 6:9924860-9924882 AAGGCAGAGCAGGCCAGGAGGGG + Intronic
1004267146 6:14158701-14158723 AGGAGCAAGAAGGGCAGCAGGGG - Intergenic
1004569509 6:16831704-16831726 AGGAGCAAAGAGGCCAGGCGTGG - Intergenic
1005047190 6:21653620-21653642 AGGGGCAAGGAAGCCAGGAGTGG - Intergenic
1005680251 6:28199587-28199609 AGAGGAAAGCAGTCCAGGGGTGG + Intergenic
1005749232 6:28867831-28867853 AGGGAAAAGCAGGCCGGGTGGGG - Intergenic
1005980067 6:30829851-30829873 AGGGATGAGCAGGGCAGGAGAGG - Intergenic
1006146622 6:31963379-31963401 AGAGGGAAGCAGGTCAGGGGTGG - Intronic
1006256405 6:32835874-32835896 AGGGGAAAGCATGCCAGGAGGGG + Intronic
1006258961 6:32853013-32853035 AGGGGAACGCAGGGCAAGAGGGG - Intronic
1006354375 6:33545858-33545880 AGGGCAAAACAGGCCAGGCGCGG + Intergenic
1006503036 6:34470022-34470044 AGGGGCAGGGTGGCCTGGAGGGG + Intronic
1006727423 6:36210061-36210083 AGGGGTCAGCAGGCCAGGGTGGG + Intronic
1007054806 6:38872005-38872027 AGAGGAAAGCAGGACAGGAATGG - Intronic
1007112629 6:39321798-39321820 AGGTGCAAACAGGCCAGGAAAGG + Intronic
1007278703 6:40694375-40694397 AGGGCCCAGCAGGGAAGGAGAGG - Intergenic
1007317717 6:41002857-41002879 AGGTGGAAGCACACCAGGAGGGG - Intergenic
1007346578 6:41235964-41235986 AGAGCTAGGCAGGCCAGGAGTGG + Intronic
1007769367 6:44180659-44180681 AGAGGTGAGCAGGCCACGAGCGG + Exonic
1007796406 6:44352047-44352069 AGGGGCAAGCAGTCTAGTACAGG + Intronic
1007961982 6:45968212-45968234 AGAGGCATGCTGGCCAAGAGTGG - Intronic
1008465017 6:51820743-51820765 AGGTACAGGCAGGCCAGCAGGGG - Intronic
1009371502 6:62908945-62908967 GGGGGCAAGGAAGCCAGTAGTGG - Intergenic
1010937848 6:81883177-81883199 AGGGGCAAGGAAGCCAGTAGTGG + Intergenic
1010938585 6:81889131-81889153 AGGGGCAAGGAAGCCAGTAGTGG + Intergenic
1011324419 6:86133889-86133911 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1011417436 6:87137309-87137331 AGGGGGAAGGAGGGGAGGAGGGG - Intergenic
1011815368 6:91183878-91183900 AGGTACGAGCAGGACAGGAGAGG + Intergenic
1013471930 6:110473813-110473835 AGGGGAAAACAGGCCAGGTGCGG - Intronic
1013793324 6:113859060-113859082 GGGCGCAGGCAGGCGAGGAGGGG - Intronic
1014042877 6:116850104-116850126 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1014453627 6:121611469-121611491 AGGGGGAAGCAGGAGAAGAGGGG - Intergenic
1014498947 6:122162931-122162953 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1014662695 6:124193280-124193302 AAGGGCAAGCAGGGCAGCAAGGG + Intronic
1015116209 6:129652141-129652163 AGGGGCAGGGATGCCAGGAAGGG - Intronic
1016267207 6:142246564-142246586 AGGGGCCACCAGGACAGGGGAGG - Intergenic
1017254899 6:152322844-152322866 AGAGACAAGCAGCCGAGGAGAGG - Intronic
1017295598 6:152790092-152790114 AAGGGCATGCAGGACAGGAAAGG - Intergenic
1017311584 6:152982810-152982832 GGGGGCGCGCACGCCAGGAGGGG - Intronic
1017515467 6:155152360-155152382 AGGGGCAGGCAGGGCCTGAGAGG - Intronic
1017765764 6:157605817-157605839 GGGGGCACGCAGGAGAGGAGAGG + Intronic
1017862937 6:158415908-158415930 AGGGGCAAGGAAGCCAGTGGTGG + Intronic
1017971035 6:159313224-159313246 AGGGGCCACCAGGCCAGCAAAGG + Intergenic
1018224815 6:161618293-161618315 TGGGGCAACAAGGTCAGGAGAGG - Intronic
1019133890 6:169896513-169896535 AGGGGGCAGCAGCCCAAGAGAGG + Intergenic
1019181117 6:170187760-170187782 ATGGCCAGGCAGGACAGGAGAGG - Intergenic
1019200073 6:170306881-170306903 ACGGTCACGCAGGCCGGGAGCGG - Intronic
1019293297 7:260911-260933 TGGTGCAAACAGGCCAGGTGGGG + Intergenic
1019473718 7:1234016-1234038 AGGGGCGAGGAGGGGAGGAGGGG + Intronic
1019562610 7:1665992-1666014 AGGGGCCGGCAGGGCGGGAGGGG + Intergenic
1019711863 7:2521497-2521519 AGTGGCCAGCACGCCAGCAGCGG - Intronic
1019755606 7:2766674-2766696 AGGTGGAAGCTGGCCAGGTGCGG - Intronic
1019910819 7:4099727-4099749 AGGGCCAAGCAGGCACAGAGTGG + Intronic
1020669105 7:11083748-11083770 TAGGGAAAGCAGGCCAGGTGTGG - Intronic
1021102550 7:16600405-16600427 AGGGACAAGCAGAACAGGTGTGG - Exonic
1021452938 7:20798511-20798533 AGGGGCAGGCCGGGCGGGAGGGG + Intergenic
1021657933 7:22890375-22890397 AAGGCCAATCAGGACAGGAGCGG - Intergenic
1022124445 7:27341938-27341960 AGTGGGAAGCAGGCCTGGAGAGG - Intergenic
1022315549 7:29241664-29241686 AGGGCAAAGCTGGGCAGGAGGGG + Intronic
1022368444 7:29748015-29748037 AGGGGAAAGCAGGAAGGGAGGGG - Intergenic
1022513012 7:30953412-30953434 AGGGGCAAGGAAGCCGGTAGTGG + Intronic
1022753581 7:33259663-33259685 AAGGGCAAACAGACCAGGAGTGG - Intronic
1022898049 7:34772905-34772927 AGGGACTAGCAGGCAAGAAGAGG - Intronic
1023263223 7:38379232-38379254 AGGGGAAGGCATCCCAGGAGAGG + Intergenic
1024281673 7:47724030-47724052 AGGAGCATGTAGGCCAGGCGTGG - Intronic
1024512210 7:50213047-50213069 AGTGGGAGGCAGGCCAGGACAGG + Intergenic
1026221148 7:68398690-68398712 AGGGGCAGGAAGGGAAGGAGGGG + Intergenic
1026255629 7:68708850-68708872 ATAAGCAAGCAGGCCAGGCGTGG - Intergenic
1026258227 7:68731500-68731522 AGGCATAAGCAGGGCAGGAGAGG + Intergenic
1026968659 7:74454945-74454967 AGGGGTGAGGAGCCCAGGAGAGG - Intronic
1027047795 7:75002675-75002697 AGGGGCGTTGAGGCCAGGAGTGG + Intronic
1027692787 7:81369213-81369235 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1029058451 7:97771613-97771635 AGGGGAAAGCAGGGAAGGAAAGG + Intergenic
1029159068 7:98538861-98538883 ATGGAGAAGCAGGCCAGGTGTGG + Intergenic
1030161956 7:106518385-106518407 AGAGGCAAGAAGGGGAGGAGTGG - Intergenic
1031964130 7:128015184-128015206 TTGGGAAAGCAGGGCAGGAGAGG - Intronic
1032006849 7:128309340-128309362 ACAGGGAAGCAGGCCAGGCGTGG + Exonic
1032020738 7:128406052-128406074 AGGGGCGAGAAGGGCGGGAGGGG - Intronic
1032300271 7:130680214-130680236 AAGGAAAAGCAGGCCAGGTGCGG + Intronic
1032501151 7:132400978-132401000 CTGTGCAAGCAGGCCAGAAGAGG + Intronic
1033040207 7:137910443-137910465 AGGTGCAGGCAGCCCAGGAAGGG + Intronic
1033051520 7:138008690-138008712 CGGGGCTAGCAGGGCAGGAGAGG + Intronic
1033487911 7:141809714-141809736 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1033957505 7:146869551-146869573 AGGAGCAAGGAAGCCAGTAGTGG + Intronic
1034256922 7:149729780-149729802 AGGGGCCAGCAGCCCAAGGGTGG - Intronic
1034824752 7:154251562-154251584 AGGAGCAAGGAAGCCAGTAGTGG + Intronic
1035049623 7:155991005-155991027 AAGGGAAGGAAGGCCAGGAGCGG - Intergenic
1035341302 7:158164324-158164346 AAGGGCACGCAGAGCAGGAGTGG + Intronic
1035881411 8:3247341-3247363 AGGAGCAAGCAGGCGGGGAGGGG - Intronic
1036401033 8:8408514-8408536 ATGGGGAAGCATCCCAGGAGAGG + Intergenic
1036644040 8:10601184-10601206 AGGGGACAGCAGGCTAGGACAGG + Intergenic
1037945756 8:22988450-22988472 AGGGGGAAGGAGGTCAGGTGCGG - Intronic
1038274289 8:26107670-26107692 AAAGGGAAGCAGGCCAGGCGAGG + Intergenic
1038310289 8:26441117-26441139 AGGGGCAGGCGGGACAGGGGAGG + Intronic
1038352108 8:26786161-26786183 AGTGAAAGGCAGGCCAGGAGCGG - Intronic
1038718430 8:30012194-30012216 AGGGGCAGGCAGGTCAGGACTGG + Intergenic
1039465642 8:37783410-37783432 TGAGGGAAGCAGGGCAGGAGAGG + Intergenic
1039566489 8:38555747-38555769 AGGGGCAAACAAGCAAGGTGTGG - Intergenic
1039803815 8:40982287-40982309 AGGTGAAAGGAGGCCAGGAAAGG - Intergenic
1041218594 8:55626476-55626498 AGTGGAAAGCAGGGAAGGAGGGG + Intergenic
1041323462 8:56638515-56638537 AAGAGTAAGAAGGCCAGGAGGGG - Intergenic
1043684025 8:83065894-83065916 AAGGGGAAGCAGGGCTGGAGGGG - Intergenic
1045035693 8:98174769-98174791 TGGGGCTTGCAGGCCAGGTGTGG - Intergenic
1045130017 8:99140638-99140660 AGGGGGAGGAAGGCAAGGAGGGG - Intronic
1045494047 8:102693393-102693415 AGGGCATAGCAGGCCAGGAGTGG + Intergenic
1046724848 8:117663149-117663171 AGAGGGAAGGAGGCAAGGAGTGG - Intergenic
1047204291 8:122791039-122791061 AGGTGCATGGAGGGCAGGAGGGG - Intronic
1047292189 8:123540798-123540820 AGGGGCAGGCAGGGCTGGAGCGG - Intronic
1047362699 8:124183729-124183751 AGGGGAAATGAGGCCAGGTGTGG + Intergenic
1047646308 8:126874122-126874144 AAGGGAAATGAGGCCAGGAGCGG - Intergenic
1048028924 8:130612824-130612846 AGGGGCAAGTAGGAAAGGAGGGG + Intergenic
1048736715 8:137510229-137510251 AGTGGGAGGCAGGGCAGGAGAGG + Intergenic
1048957816 8:139551272-139551294 AGGGACAATCAGGCAAGGATAGG + Intergenic
1049216277 8:141409812-141409834 CAGCGCAAGCAGGGCAGGAGGGG - Intronic
1049343888 8:142128323-142128345 CGGGGGACGCAGGCCAGGAGAGG + Intergenic
1049408170 8:142460837-142460859 AGTGGCATGAGGGCCAGGAGTGG - Intronic
1049431057 8:142565122-142565144 AGGAGCGAGCTGCCCAGGAGGGG + Intergenic
1049438503 8:142598638-142598660 AGGGGCAGGCAGGGCAGGCTGGG - Intergenic
1049578656 8:143400960-143400982 AGGGGCTTGCAGGCAAGGTGGGG + Intergenic
1050053237 9:1624670-1624692 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1050072238 9:1827484-1827506 AGAGTCAAGAAGGCTAGGAGAGG - Intergenic
1050303833 9:4286305-4286327 AGGGGCCAGGAGTCCCGGAGTGG + Exonic
1050525613 9:6543874-6543896 AGGGGCAAGGAGGACAGGAGGGG + Intronic
1050636581 9:7619137-7619159 AGGCACCAGCAGGGCAGGAGAGG + Intergenic
1051076002 9:13237150-13237172 AATGGTAAGCAGGCCAGGAGCGG + Intronic
1051106641 9:13587898-13587920 TGGGGCAAGGAGACCAGAAGTGG - Intergenic
1051408034 9:16760110-16760132 GGGGGAAGGCAGGACAGGAGAGG + Intronic
1052785372 9:32823171-32823193 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1052947302 9:34178845-34178867 AGGGGGAAGGAGGAAAGGAGGGG - Intergenic
1053019479 9:34685001-34685023 AGGGGCAGGCAGGGCAGGGTTGG - Intergenic
1053604937 9:39648125-39648147 AGGAGCAAGCAAGCCAGTGGTGG - Intergenic
1053862813 9:42404475-42404497 AGGAGCAAGCAAGCCAGTGGTGG - Intergenic
1054248604 9:62694290-62694312 AGGAGCAAGCAAGCCAGTGGTGG + Intergenic
1054562718 9:66728816-66728838 AGGAGCAAGCAAGCCAGTGGTGG + Intergenic
1056382546 9:86068156-86068178 AGAGGCAAGCAGGCCATGTGAGG + Intronic
1056752200 9:89360254-89360276 CGGGGCCAGCAGGAAAGGAGAGG + Intergenic
1056771671 9:89482021-89482043 AGGGGAAAGGAGGCAGGGAGAGG + Intronic
1056778780 9:89533758-89533780 AGGGTCAAGCAGGGCTGGAGAGG + Intergenic
1057362289 9:94384628-94384650 ATGGGCAAAGAGGCCAGGAATGG - Intronic
1057661054 9:97003475-97003497 ATGGGCAAAGAGGCCAGGAATGG + Intronic
1057833623 9:98426705-98426727 AAGTGTTAGCAGGCCAGGAGTGG + Intronic
1057897477 9:98921385-98921407 AGGGGGAAAAAGGCCGGGAGTGG - Intergenic
1057907496 9:98993964-98993986 ATGGGGAAGAAGGCAAGGAGGGG - Intronic
1058037197 9:100265784-100265806 AGGACCAAACAGGCCAGGTGCGG + Intronic
1058094751 9:100846937-100846959 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1058096212 9:100862949-100862971 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1058923147 9:109637413-109637435 GGGGGCAAGGAGGCCGAGAGAGG + Intergenic
1059379209 9:113910104-113910126 AGGGGCAGCCAGGCGGGGAGTGG - Intronic
1059428726 9:114237149-114237171 GGGGGCAAGCAGGGCAGGGCAGG + Intronic
1059495676 9:114707270-114707292 AGGGACAAGATGGCCAGGAATGG - Intergenic
1060186911 9:121569031-121569053 AGGGACAGGCAGGCATGGAGTGG + Intronic
1060212207 9:121717602-121717624 AGGAGTAAACACGCCAGGAGGGG - Intronic
1060295671 9:122341323-122341345 AGTGGGTAGCAGGCCAGGCGTGG - Intergenic
1060526486 9:124323993-124324015 AGGGGGAACCATGCCAGGTGAGG - Intronic
1060865170 9:126989570-126989592 AGTGGAAGGCAGGCCAGGGGTGG + Intronic
1061002684 9:127911186-127911208 CAGGGCAGGCAGGCCAGGAGTGG + Intronic
1061087887 9:128409747-128409769 TGGGGAAAGCAGGCTGGGAGAGG - Intergenic
1061144156 9:128787408-128787430 AGGGGCAGCCTGGCCAGGAGTGG - Intronic
1061435003 9:130555541-130555563 AGGGGCAGAGAGACCAGGAGGGG - Intergenic
1061656433 9:132094802-132094824 AGGAGCAAGAATGCCAGTAGTGG + Intergenic
1061754187 9:132801216-132801238 AGGGACAAACTGGCCAGGCGTGG - Intronic
1061784059 9:133014520-133014542 AAGGGCAAGCATCCCAAGAGAGG + Intergenic
1061839828 9:133352170-133352192 AGAGGCTGGCAGGCCAGTAGGGG - Intronic
1062029586 9:134356188-134356210 TGGGGCAAGGAAGCCAGGTGAGG - Intronic
1062031079 9:134362285-134362307 AGGGGCGACCAGGCAGGGAGGGG - Intronic
1062032253 9:134366962-134366984 AGTGGCACGCAGGGCAGGGGTGG - Intronic
1062165814 9:135106720-135106742 AAGAGCACGCAGGTCAGGAGAGG - Intronic
1062324949 9:136008324-136008346 AGAGGAAGGCAGGGCAGGAGAGG + Exonic
1062388353 9:136324149-136324171 AGGAAGAAGCAGGCCGGGAGTGG - Intergenic
1062400378 9:136370121-136370143 GGGGGCAGGCGGGCAAGGAGAGG + Intronic
1203780007 EBV:96000-96022 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1203780011 EBV:96009-96031 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1203780031 EBV:96063-96085 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1203780061 EBV:96144-96166 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1203780091 EBV:96225-96247 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1203780110 EBV:96276-96298 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1203780129 EBV:96327-96349 AGGGGCAGGAGGGGCAGGAGGGG + Intergenic
1185647970 X:1628582-1628604 AGGGGAGAGCAGGGGAGGAGAGG - Intronic
1185990500 X:4889698-4889720 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1187030772 X:15486061-15486083 AAGGCCAATCAGGCCAGGCGTGG + Intronic
1187032211 X:15499598-15499620 AGGGTGAAGCAGGGCAAGAGTGG - Intronic
1187406690 X:19010624-19010646 AGGGGCCAGCATGTCAGGCGGGG + Exonic
1187472938 X:19585599-19585621 AGAGGCAGCCAGGCAAGGAGGGG + Intronic
1187474934 X:19602233-19602255 AGCAGCAAGCAGGAGAGGAGAGG + Intronic
1188797357 X:34482638-34482660 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1189125134 X:38437770-38437792 AGGGGCCAGAAGGCAAGAAGAGG + Intronic
1189309276 X:40008639-40008661 AGGGGGGAGCGGGTCAGGAGTGG + Intergenic
1190734985 X:53250246-53250268 AGGGGTAAGCAGGCTAGAACGGG + Intronic
1190964750 X:55288390-55288412 AGAGGAAAGCAGGCCAGGCTCGG - Intronic
1191732417 X:64351594-64351616 AGGAGCAAGAAAGCCAGTAGTGG + Intronic
1192175705 X:68883901-68883923 AGTGGTAAGCAGACCAGGGGAGG - Intergenic
1192262043 X:69511287-69511309 AGGGGCATGCAGGCCAGAAGAGG - Intronic
1192467918 X:71370638-71370660 AGTTTCAAGCAGGCCAGGCGGGG - Intronic
1192621768 X:72683145-72683167 AGTGGAAAACAGGCCAGGTGTGG + Intronic
1192811970 X:74555008-74555030 AGGCATAAGCAGGGCAGGAGAGG - Intergenic
1192899985 X:75486516-75486538 GTGGGCAGGCAGGCAAGGAGGGG + Intronic
1193379563 X:80802813-80802835 AATGTCAAGCAGGCCAGGTGCGG + Intronic
1193450157 X:81655630-81655652 AGGGGCAAGAAAGCCAGTAGTGG + Intergenic
1194076485 X:89400475-89400497 TGGTGCAGGCAGGCAAGGAGGGG - Intergenic
1194505326 X:94727125-94727147 TAGGGCAAGCTGGCCAGGCGTGG - Intergenic
1195843727 X:109203650-109203672 AGGGGATGGCAGGCCAGGGGAGG - Intergenic
1195850493 X:109277177-109277199 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1197026171 X:121752230-121752252 AGGAGCAAGGAAGCCAGGGGTGG - Intergenic
1197181570 X:123542327-123542349 AGGGTGAAGCAGGCCAGGCCTGG - Intergenic
1197633235 X:128886366-128886388 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1197896143 X:131317598-131317620 ATTGGCTAGCAGGCCAAGAGTGG - Intronic
1198047450 X:132916829-132916851 AGGAGCAAGGAAGCCAGTAGTGG - Intronic
1198089511 X:133313579-133313601 AGGAGCAAACAGGACTGGAGGGG + Intronic
1198185970 X:134254387-134254409 AGAGACCAGCAGGCCAGAAGAGG - Intergenic
1198241777 X:134794883-134794905 AGGGGCAAGGAGACCAGGCCTGG - Intronic
1199287083 X:146065461-146065483 AGGAGCAAGGAAGCCAGTAGTGG - Intergenic
1199342252 X:146694515-146694537 AGAGGAATGCAGGCCAGGCGTGG - Intergenic
1199413965 X:147558399-147558421 AAGGGTAAGTAGGCCAGGTGCGG - Intergenic
1200015869 X:153163455-153163477 AGGAGCAAGGAAGCCAGTAGTGG + Intergenic
1200282346 X:154787760-154787782 AAGGGAAAGCTGGCCAGGTGTGG - Intronic
1200429125 Y:3055995-3056017 TGGTGCAGGCAGGCAAGGAGGGG - Intergenic
1201077881 Y:10200430-10200452 AGGGGCAGGCATGGCAGGAGAGG - Intergenic