ID: 907834938

View in Genome Browser
Species Human (GRCh38)
Location 1:58099807-58099829
Sequence TCAGTTCCACACTTATTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907834938_907834939 -9 Left 907834938 1:58099807-58099829 CCAGAAAATAAGTGTGGAACTGA No data
Right 907834939 1:58099821-58099843 TGGAACTGAGACTCACGTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 138
907834938_907834943 19 Left 907834938 1:58099807-58099829 CCAGAAAATAAGTGTGGAACTGA No data
Right 907834943 1:58099849-58099871 CTCAGTTTTGAACACCACTCTGG No data
907834938_907834940 -5 Left 907834938 1:58099807-58099829 CCAGAAAATAAGTGTGGAACTGA No data
Right 907834940 1:58099825-58099847 ACTGAGACTCACGTCCAGGACGG No data
907834938_907834941 -4 Left 907834938 1:58099807-58099829 CCAGAAAATAAGTGTGGAACTGA No data
Right 907834941 1:58099826-58099848 CTGAGACTCACGTCCAGGACGGG 0: 1
1: 0
2: 0
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907834938 Original CRISPR TCAGTTCCACACTTATTTTC TGG (reversed) Intronic
No off target data available for this crispr