ID: 907837400

View in Genome Browser
Species Human (GRCh38)
Location 1:58123355-58123377
Sequence AGATGCTTTCAGATGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907837400_907837403 20 Left 907837400 1:58123355-58123377 CCTTACTCCATCTGAAAGCATCT No data
Right 907837403 1:58123398-58123420 AGAATGATAAACTATATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907837400 Original CRISPR AGATGCTTTCAGATGGAGTA AGG (reversed) Intronic
No off target data available for this crispr