ID: 907840508

View in Genome Browser
Species Human (GRCh38)
Location 1:58152545-58152567
Sequence CTCAGTCTTCTCTGCAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 15, 3: 64, 4: 403}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907840505_907840508 7 Left 907840505 1:58152515-58152537 CCTTAGGAACATGCATGCAAATC 0: 1
1: 0
2: 0
3: 15
4: 180
Right 907840508 1:58152545-58152567 CTCAGTCTTCTCTGCAAAATGGG 0: 1
1: 0
2: 15
3: 64
4: 403
907840502_907840508 29 Left 907840502 1:58152493-58152515 CCTTCAAAGTACTACCTGTGCAC 0: 1
1: 0
2: 1
3: 8
4: 97
Right 907840508 1:58152545-58152567 CTCAGTCTTCTCTGCAAAATGGG 0: 1
1: 0
2: 15
3: 64
4: 403
907840501_907840508 30 Left 907840501 1:58152492-58152514 CCCTTCAAAGTACTACCTGTGCA No data
Right 907840508 1:58152545-58152567 CTCAGTCTTCTCTGCAAAATGGG 0: 1
1: 0
2: 15
3: 64
4: 403
907840504_907840508 15 Left 907840504 1:58152507-58152529 CCTGTGCACCTTAGGAACATGCA 0: 1
1: 0
2: 0
3: 10
4: 116
Right 907840508 1:58152545-58152567 CTCAGTCTTCTCTGCAAAATGGG 0: 1
1: 0
2: 15
3: 64
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907840508 Original CRISPR CTCAGTCTTCTCTGCAAAAT GGG Intronic
900587161 1:3438804-3438826 CTTATTCTTTTCTGGAAAATGGG - Intergenic
901066395 1:6496665-6496687 CTCAGTCCTCCCTTCAAAAGAGG + Intronic
901405346 1:9041358-9041380 CTCTTTCTGGTCTGCAAAATGGG + Intronic
902515597 1:16987851-16987873 TTCAGTCTTCCCTGCAGATTGGG + Intronic
902679861 1:18035614-18035636 CCCAGTCTCCTCTGTAAAACAGG + Intergenic
903022389 1:20403436-20403458 ATCAGTCACTTCTGCAAAATAGG - Intergenic
903039828 1:20521063-20521085 CTCTTTCTCATCTGCAAAATGGG - Intergenic
903040083 1:20522933-20522955 CTCTTTCTCATCTGCAAAATGGG + Intergenic
903250783 1:22052058-22052080 TTCCGTCTTCTCTGCAAAATGGG + Intergenic
903649321 1:24913419-24913441 AGCTGTCTTATCTGCAAAATGGG + Intronic
904026177 1:27504977-27504999 CTGAGTGTCCTCTGCAAAACAGG - Intergenic
905012827 1:34758824-34758846 CTTAAGCTTCTCTCCAAAATGGG + Intronic
905775012 1:40662815-40662837 CTCAGTCTCCTCTGGAAAATAGG - Intronic
905782326 1:40723044-40723066 CTCAACCTTATCTGTAAAATTGG + Intronic
905822374 1:41003605-41003627 CTCCGTTTTTTCTGTAAAATGGG + Intronic
906073452 1:43034716-43034738 CTCAGTCTCTTCTGTAGAATAGG - Intergenic
906193499 1:43914317-43914339 CTTAGTCCCCTCTGAAAAATGGG + Intronic
906715448 1:47965272-47965294 GTCTGACTTTTCTGCAAAATTGG + Intronic
907446871 1:54513822-54513844 CTCAGCCTTAGCTGCAAAATGGG + Intergenic
907840508 1:58152545-58152567 CTCAGTCTTCTCTGCAAAATGGG + Intronic
909479979 1:76120545-76120567 TTCAGTGTCTTCTGCAAAATGGG - Intronic
909691116 1:78409211-78409233 CTCAGGCTTCCCAGCAAAAGTGG + Intronic
909920143 1:81371247-81371269 CTCAGTGTTCTGTGCAAATTAGG + Intronic
909926675 1:81445791-81445813 CACATTCTTATTTGCAAAATGGG + Intronic
910208333 1:84770044-84770066 TTCAGCCATCTCTGAAAAATTGG + Intergenic
910483812 1:87687887-87687909 TTCAGTTTTCTCTATAAAATGGG - Intergenic
910711167 1:90182928-90182950 CTCAGTTTTATGTGCAAAATAGG + Intergenic
911062847 1:93762720-93762742 CTCCCTCTTCTCTGCAAAGATGG + Intronic
911330969 1:96525370-96525392 CTCAGTCATCTAAGGAAAATAGG - Intergenic
911695583 1:100887579-100887601 AAATGTCTTCTCTGCAAAATGGG - Intronic
915166424 1:153950410-153950432 CTCAGTCTTTCCTACAAAAGAGG + Intronic
915684461 1:157617454-157617476 TTCATTTTTCTCTGAAAAATGGG + Intergenic
916016162 1:160751402-160751424 CTCTGTGTTCTCTCCAGAATGGG - Exonic
916391130 1:164332038-164332060 CTCAATATTCTCTGTAATATAGG - Intergenic
916933997 1:169609104-169609126 CTCAGTATCTTCTGTAAAATGGG - Intronic
917074628 1:171191587-171191609 CTCATTTTCCTCTGTAAAATGGG - Intronic
917715984 1:177738304-177738326 CTCATTCACATCTGCAAAATGGG + Intergenic
918012781 1:180603272-180603294 CTCAGTCCCCACTGGAAAATGGG - Intergenic
918063687 1:181084987-181085009 CTCAGTCTCCTGTGAAAAATGGG - Intergenic
919413732 1:197279999-197280021 CTTAGATATCTCTGCAAAATGGG - Intronic
919745783 1:201008444-201008466 CTGAGCCTCATCTGCAAAATGGG - Intronic
921863672 1:220065646-220065668 CTCAGTTTCCTCTTTAAAATGGG + Intronic
922118410 1:222636880-222636902 CTCTGCCTCCTCTGCAAGATTGG + Intronic
924185487 1:241484954-241484976 AGCAGTCTTCTCTGCAAAATGGG - Intergenic
924405204 1:243737234-243737256 CTCATACTCATCTGCAAAATGGG + Intronic
924673551 1:246152804-246152826 CTCAGCCACATCTGCAAAATGGG + Intronic
1063240412 10:4163612-4163634 CAAAGTCTTCTCTGCCAACTTGG + Intergenic
1063507626 10:6615379-6615401 CTCAATTTTCTGTGCAAATTGGG + Intergenic
1063610415 10:7557388-7557410 CTCAGATTTCTCAGCAAAATAGG + Intergenic
1063930880 10:11027443-11027465 CTCAGTCTCCTCTCCAACACAGG - Intronic
1064428531 10:15251774-15251796 CTCAGTATTTTGTGTAAAATTGG - Intronic
1064531670 10:16316733-16316755 TTCAGTATCCTCTGCAAAACCGG + Intergenic
1065146585 10:22774818-22774840 CTCAGTTTCATCTGCAAAATGGG + Intergenic
1067462874 10:46470805-46470827 CTCAGTCTTGTCAACAACATAGG + Intergenic
1067624320 10:47913833-47913855 CTCAGTCTTGTCAACAACATAGG - Intergenic
1067910370 10:50340386-50340408 GTCAGACTTCACTGCAAAACAGG - Intronic
1068396862 10:56473394-56473416 TTCTGTGTTCTCTGCAAATTGGG + Intergenic
1068419943 10:56778462-56778484 CTCAATCTACTCAGTAAAATAGG + Intergenic
1069065749 10:63940095-63940117 CTCAATCTTATCTAAAAAATGGG + Intergenic
1069100094 10:64309524-64309546 CTCATTTTTATCTGTAAAATGGG - Intergenic
1069743236 10:70698870-70698892 CTCACTGTTCTCAGCAGAATGGG - Intronic
1070819920 10:79348555-79348577 CTCAGTTTCTTCTGGAAAATAGG + Intronic
1071295051 10:84213393-84213415 CTCAGACCTCTCTGCAACGTGGG + Intronic
1071843198 10:89494490-89494512 CTCAATCTGCTGTACAAAATTGG - Intronic
1072448050 10:95516532-95516554 CTCAATCTCCTCTGTAAAATGGG - Intronic
1072557014 10:96526349-96526371 CTCATTTTTATCTGTAAAATGGG - Intronic
1072945036 10:99802343-99802365 CTGATTTTTCTCTGTAAAATAGG - Intronic
1073278754 10:102335701-102335723 CTCATTTTTATCTTCAAAATGGG + Intronic
1073496983 10:103900987-103901009 CTCAGTTTCCTCTCTAAAATGGG - Intronic
1074618168 10:115091969-115091991 CTCTTTCTCATCTGCAAAATGGG + Intergenic
1074680409 10:115900619-115900641 CTCAGTGCTATCTACAAAATGGG - Intronic
1075968410 10:126632434-126632456 CTCAGTATTATCTACCAAATGGG - Intronic
1075968414 10:126632475-126632497 CTCAGTATTATCTACCAAATGGG + Intronic
1077246979 11:1544470-1544492 CAGGGTCTTGTCTGCAAAATGGG - Intergenic
1077488808 11:2851070-2851092 CCCAGTCCTGTCTGCGAAATGGG + Intergenic
1077970727 11:7187274-7187296 CTAAGCCTTCTCTGTTAAATAGG + Intergenic
1078607413 11:12789197-12789219 GTAAGTCTCCTCTGTAAAATGGG + Intronic
1078861099 11:15247593-15247615 CTGTTTCTTCTCTGTAAAATGGG - Intergenic
1078925981 11:15875400-15875422 CATTGTCTTCTCTGCAAAATGGG - Intergenic
1079315621 11:19405716-19405738 CTCAGTCCCATCTGTAAAATGGG + Intronic
1079591024 11:22182779-22182801 CTCAATCTGCTCAACAAAATTGG - Intergenic
1079910164 11:26299899-26299921 TTCAGTCTTCTCAGTGAAATAGG + Intergenic
1080403384 11:31957368-31957390 CTCAGTTTCATCTGGAAAATGGG - Intronic
1080743065 11:35083381-35083403 CACCTTCTTATCTGCAAAATAGG - Intergenic
1081519724 11:43870222-43870244 TTCAGTCTTCTTTGTAAAATGGG + Intergenic
1081621882 11:44623723-44623745 CTTAGTCTTATCGGGAAAATGGG + Intergenic
1081648720 11:44808529-44808551 CTCACTTTTCTCTGCAGCATAGG + Intronic
1081754878 11:45537402-45537424 CTTTTTCTTGTCTGCAAAATGGG - Intergenic
1082124706 11:48418460-48418482 CTCAGTCTCATGTTCAAAATTGG - Intergenic
1082251350 11:49984307-49984329 CTCAGTCTCATGTTCAAAATTGG + Intergenic
1082909905 11:58359831-58359853 CTATATCTTCTCTGCAGAATTGG - Intergenic
1084104535 11:66972624-66972646 TTCAGTCTCATCTGTAAAATGGG - Intergenic
1084554255 11:69866434-69866456 CTTATCCTTCTCTGTAAAATGGG - Intergenic
1084711513 11:70846797-70846819 CCCACCCTTCTCTGAAAAATGGG + Intronic
1084966568 11:72747660-72747682 CTTAGTCTCATCAGCAAAATGGG + Intronic
1085732688 11:79012916-79012938 CTCAGTGTCATCTGCAAAAGAGG - Intronic
1085770001 11:79316482-79316504 CCCAGTCTTCTCTGTACAACTGG - Intronic
1086738757 11:90340834-90340856 TTCACTGTTCTCTGCAAAATTGG + Intergenic
1086948104 11:92864285-92864307 CTCAGTCTATTATGAAAAATTGG - Intronic
1087240709 11:95774238-95774260 CACAGTTTCCTCTGTAAAATGGG + Intronic
1087786591 11:102361560-102361582 GTCAGTGTCCTCTGCAAAGTAGG + Intronic
1089008377 11:115112466-115112488 CTCAGTTTTCTCAGTAAAAGGGG + Intergenic
1089062920 11:115640937-115640959 CTTAGTCTCATCTGTAAAATGGG - Intergenic
1090026687 11:123173638-123173660 CTCATCCTCCTCTGTAAAATGGG + Intronic
1090204713 11:124877920-124877942 CTCTTTCTTCTCTGCAGAAGCGG + Exonic
1090435485 11:126683513-126683535 TTCTTTCTTATCTGCAAAATGGG + Intronic
1092104864 12:5914246-5914268 CTCAGTCCTCTCTGCTAAATGGG + Intronic
1092595546 12:10000736-10000758 CTCAGGCTTTTCTGGAAGATTGG + Intronic
1096318881 12:50593573-50593595 CTCTTTCTCATCTGCAAAATGGG - Intronic
1097237376 12:57549664-57549686 CACAGTCCTCTCTCCAAACTGGG - Intergenic
1097406863 12:59199817-59199839 CTCAGTGTTCTCTGAGAAAAGGG + Intergenic
1097409947 12:59239614-59239636 CTCATTCTTTCCTGCAAAAGAGG - Intergenic
1099410510 12:82320965-82320987 CTCAGTATCATGTGCAAAATAGG + Intronic
1100002126 12:89849857-89849879 CTCAGTTTTCTCTGTAAAATGGG + Intergenic
1100088510 12:90939996-90940018 CTCAGGTTTATCTGTAAAATGGG + Intronic
1100771424 12:97927030-97927052 CTCATTCTGCTATTCAAAATGGG - Intergenic
1101169888 12:102080620-102080642 CTCAATCTCATCTGAAAAATGGG - Intronic
1102548882 12:113676439-113676461 CTCAGTCTTGGCTATAAAATGGG + Intergenic
1102595367 12:113988236-113988258 CTTAGCCTTATCTGTAAAATGGG - Intergenic
1102634125 12:114307961-114307983 CTCAGGTTTTTGTGCAAAATTGG - Intergenic
1103960240 12:124604876-124604898 CAAAGTCTCCTCTGTAAAATGGG - Intergenic
1106700413 13:32222718-32222740 CACTTTCTTCTCTACAAAATGGG + Intronic
1108582657 13:51840062-51840084 CTTGGTTTTCTCTGTAAAATGGG - Intergenic
1110072373 13:71192846-71192868 CTCATTCTTCTTTTCAAAAGGGG + Intergenic
1110130496 13:72002875-72002897 CTAAGTCCTTTCTGCAATATTGG + Intergenic
1110137875 13:72090635-72090657 TTCAATTTTCTCAGCAAAATAGG - Intergenic
1110552778 13:76827226-76827248 CTCAGTCTTCTCTGATCATTTGG - Intergenic
1111763756 13:92499819-92499841 CTAAGTCTTCATTGAAAAATGGG + Intronic
1112190508 13:97172864-97172886 AACACTCTTCTGTGCAAAATAGG - Intergenic
1112642210 13:101288584-101288606 ATCAGTCTTCTCTGTTAATTAGG + Intronic
1112824508 13:103376536-103376558 TTCTGTCTTCTTTGTAAAATCGG + Intergenic
1113365823 13:109675060-109675082 CTCAGTGTTCTCTGTAAAATGGG + Intergenic
1113748107 13:112759745-112759767 TTCTGTCTTCTTGGCAAAATAGG - Intronic
1115456800 14:33613353-33613375 CTCAACCTTCTCAGCAATATAGG - Intronic
1116534150 14:46009470-46009492 CTCAATTTTCTCTGCAAAGTGGG - Intergenic
1116996708 14:51332297-51332319 CTCAGTTTCCTCTGTAAGATGGG + Intergenic
1118039176 14:61899154-61899176 CTTAGTTTCCTCTGCAGAATGGG - Intergenic
1118207847 14:63739700-63739722 ATAACTCTTCACTGCAAAATAGG + Intergenic
1119797118 14:77408649-77408671 CTCAGTCTCATCTGTAAAATGGG - Intronic
1120356497 14:83441204-83441226 CTCAGGCTTCTCTGTAAGTTTGG - Intergenic
1121351829 14:93179593-93179615 CTCAGTCTCATCCGTAAAATGGG + Intergenic
1121936525 14:98024433-98024455 CTCAATTCTATCTGCAAAATGGG - Intergenic
1122686491 14:103510470-103510492 CTCAGTCTTCTCTGTCAAACAGG - Intergenic
1123775556 15:23575630-23575652 CTCACTCATCTCTGCAAGAATGG - Intronic
1125241790 15:37584440-37584462 CTCAGTGTTCTCTCCAACAGAGG + Intergenic
1125514620 15:40311056-40311078 CTCAGTCTGCCCTGCAAAGGTGG - Intergenic
1126074939 15:44900084-44900106 CTCTTTCTTCTCTGTAAGATGGG + Intergenic
1126083423 15:44987731-44987753 CTCTTTCTTCTCTGTAAGATGGG - Intergenic
1128801012 15:70497045-70497067 CACATCCTTCTCTGTAAAATGGG - Intergenic
1130131642 15:81148340-81148362 CTCAGCCTCCTTTCCAAAATAGG - Exonic
1130228942 15:82081904-82081926 CTCAGTCTTGTCTGCAAATTTGG + Intergenic
1131132844 15:89911076-89911098 CTCAGTCTTATCTACAAAATGGG + Intronic
1131400573 15:92122293-92122315 CTTCGTCTTCTCTGTAAAGTAGG + Intronic
1133230119 16:4362422-4362444 CTGAGTCTCACCTGCAAAATAGG - Intronic
1133272789 16:4618858-4618880 CTCAGTTTTATCTGTAAAATAGG - Intronic
1133333491 16:4990995-4991017 CTCAGTGTTATCTGTTAAATGGG + Intronic
1133743140 16:8666612-8666634 CTCAGTCCCATCTGTAAAATGGG - Intergenic
1134330070 16:13242569-13242591 GTCAGTCTTCTCTTCATTATAGG - Intergenic
1134790471 16:16985014-16985036 GTCAGTCTTCTCTGAAATCTAGG - Intergenic
1135263619 16:21002395-21002417 CTCAGTTATCTCAGCAAAAAAGG - Intronic
1135828028 16:25747585-25747607 TTCAGTTTTCTCTGCAAAAGAGG - Intronic
1135943747 16:26845470-26845492 CTCAGTCTAGTCTATAAAATAGG - Intergenic
1136061108 16:27727031-27727053 CTCAGCTTTATCTGAAAAATGGG + Intronic
1136514677 16:30761092-30761114 CTCAGTCTCATCTGTAAAATGGG + Exonic
1137376249 16:47954444-47954466 CTCCCTCTTTTCTGCAAAATGGG - Intergenic
1137760942 16:50939834-50939856 CTCAGTTTTCTCTACAAAATGGG + Intergenic
1138057363 16:53849211-53849233 CTCTGCCTTCACTGTAAAATGGG + Intronic
1138116523 16:54364941-54364963 CTTTGTCTTCTCTGCCAATTTGG + Intergenic
1138652442 16:58468390-58468412 CTCAGTCTTATCAGTAAAATGGG + Intronic
1138863783 16:60792176-60792198 AACACTCTTCTCTGTAAAATGGG + Intergenic
1139161510 16:64515931-64515953 TCCTGTCTTCTCTGCATAATAGG - Intergenic
1139328224 16:66168004-66168026 CTCAGCCTTCTCTCCAGAAGAGG - Intergenic
1140648869 16:77065129-77065151 CACTGCCTTATCTGCAAAATGGG + Intergenic
1140892375 16:79296114-79296136 CTTAGCCTTATCTGTAAAATGGG + Intergenic
1141039210 16:80656854-80656876 CTAAGTCTTCCCTGCAAGATGGG + Intronic
1141487290 16:84349181-84349203 CTCACTATTCCCTGCAAATTGGG - Intergenic
1142369060 16:89667918-89667940 CTCAGTTTTGTCTGAAATATGGG + Intronic
1143250226 17:5518041-5518063 CTCATCCTTCTGTGGAAAATTGG - Intronic
1143923341 17:10348411-10348433 CTCAGTTTTGTCTGTAAAATGGG + Intronic
1144325886 17:14179192-14179214 CTCTGTCTTCTCTGAAAACAAGG - Intronic
1144474761 17:15576080-15576102 CTCTGTCTTCTCTGAAAACAAGG - Intronic
1144828121 17:18117927-18117949 CTCAGTTTCCTCTGAAGAATGGG - Intronic
1145100582 17:20073280-20073302 CTCAGTCTGCTCTTCACAAATGG - Intronic
1145301762 17:21645891-21645913 CTCAGTGTCCTCTGCATAGTGGG + Intergenic
1145348549 17:22057433-22057455 CTCAGTGTCCTCTGCATAGTGGG - Intergenic
1146114954 17:30127274-30127296 TTCATTATGCTCTGCAAAATGGG - Intronic
1146522621 17:33537994-33538016 CTCAGTTTTCTCTGTAGAAAAGG + Intronic
1147605094 17:41769858-41769880 CTCAGTAATCTCTGTAAAATAGG + Intronic
1147955615 17:44132456-44132478 CTTGGTCTTATCTGGAAAATAGG + Intergenic
1148759482 17:49992124-49992146 CTTCCTCTTGTCTGCAAAATGGG + Intronic
1148830453 17:50427414-50427436 CTTAGTTTTCTCAGCAAATTAGG - Intronic
1148972956 17:51500293-51500315 CTCACTATTTTCTGCAAAATTGG + Intergenic
1149116500 17:53103443-53103465 GTCAGTTCTTTCTGCAAAATAGG + Intergenic
1149637960 17:58185422-58185444 CTCAGTGTTCTCATGAAAATAGG + Intergenic
1149971449 17:61222381-61222403 CTCAGTTTTCTCTGGAAACTGGG + Intronic
1150959546 17:69898639-69898661 TTCAGTTTTCTCTGTAAAATAGG - Intergenic
1151427605 17:74041173-74041195 CACATTCTTCTCTGTAAAATGGG + Intergenic
1152368107 17:79869141-79869163 CTCTTCCTTTTCTGCAAAATGGG - Intergenic
1152775565 17:82199534-82199556 CTCATTCTTCTCTCCAAACCTGG - Intronic
1153428423 18:4990459-4990481 CTCTGTCTTCTTTTCCAAATGGG - Intergenic
1155869707 18:31011024-31011046 CTCTGTGTTATCTGTAAAATGGG - Intronic
1156389948 18:36640998-36641020 ATCCTTCTTCTCTGCAACATGGG + Intronic
1157017591 18:43735991-43736013 CTCACTATTCTCTGAAAACTTGG + Intergenic
1158006746 18:52681139-52681161 TGCATTCTTCTCTGTAAAATGGG - Intronic
1158955120 18:62530319-62530341 CTGAGTCTTACCTGTAAAATGGG + Intronic
1162056012 19:8064536-8064558 CTCAGTTTTCCCTGTAAAATGGG + Intronic
1162299984 19:9838962-9838984 CTCAGCTTTCTCTGTAAAATGGG + Intronic
1162539126 19:11283185-11283207 TTTAGTCTTATCTGTAAAATTGG - Intergenic
1163564735 19:18044146-18044168 TTCAGACTTCTCTCCAAAACTGG - Intergenic
1164255117 19:23521319-23521341 GTGAGTCTTCTCTTCTAAATAGG - Intergenic
1164969381 19:32518170-32518192 CTCTATTTTCTCTGTAAAATTGG - Intergenic
1165733021 19:38158524-38158546 CTCAGTCTTCTGTGCAGAGGAGG + Intronic
1165931119 19:39359642-39359664 TACAGTCTCCTCTGTAAAATGGG - Intronic
1166224173 19:41384670-41384692 CTTTTTCTCCTCTGCAAAATGGG + Intronic
1167041765 19:47027048-47027070 CTCAGCCTCATCTGTAAAATGGG - Intronic
1167066296 19:47188684-47188706 CTGAGCCTCCTCTGCAAAATGGG - Intronic
1167462282 19:49631973-49631995 CTCAGTCTCATCTGTAAAATGGG - Intergenic
925033540 2:670358-670380 CTCAGTCTCTTCTGCTAAAGAGG - Intronic
925633443 2:5918014-5918036 CTCAGTGTTCTTATCAAAATCGG - Intergenic
928180958 2:29067933-29067955 CTCAGCCTTCTCCTCAGAATAGG - Intronic
929289211 2:40170054-40170076 ATCAGTCTTCTCTGCAGGCTGGG + Intronic
930021513 2:47004648-47004670 CTCATTCCCCTCTGCCAAATGGG - Intronic
930376039 2:50568000-50568022 CTCAGTTTCTTCTGAAAAATGGG - Intronic
930956006 2:57203627-57203649 CTCTAGCTTCTCTGCAAAGTAGG + Intergenic
930991522 2:57662221-57662243 ATCAGCTTTCTCTGCCAAATTGG + Intergenic
931840009 2:66138355-66138377 CTCAATTTTATCTGTAAAATGGG + Intergenic
932875439 2:75446469-75446491 CTCAGCCGTATCTGTAAAATGGG + Intergenic
933134329 2:78712880-78712902 CTCAGTATTCTCTTCTAAAGAGG - Intergenic
933637767 2:84726042-84726064 GTCAGTCTCCTCACCAAAATAGG - Intronic
935922080 2:108026868-108026890 CTTAGTTTTGTCTGTAAAATGGG - Intergenic
936665330 2:114588168-114588190 CTCAGCTTTCTCTTAAAAATGGG - Intronic
936969327 2:118161758-118161780 CTCACTCTTCAATGCAACATCGG + Intergenic
937689761 2:124742195-124742217 TGCAGTCTGCTCTGCCAAATGGG + Intronic
938098502 2:128479249-128479271 CTCGTTCTCATCTGCAAAATGGG + Intergenic
940888363 2:159011106-159011128 CTCACTCTCATCTGTAAAATGGG - Intronic
946103936 2:217352826-217352848 CTCTGTTTTCCCTGTAAAATAGG - Intronic
946428186 2:219610909-219610931 TTCTTTCTTCTTTGCAAAATGGG + Intronic
946870575 2:224080700-224080722 CTCAGTCTTGCCTGTAAAATGGG + Intergenic
946993612 2:225364776-225364798 TTGAGCCTTCTTTGCAAAATAGG - Intergenic
947348656 2:229220249-229220271 CTCAGTTTTCTCTGTAAATGAGG - Intronic
948088060 2:235267160-235267182 TTCTGTCTTCTCTGTAAAGTAGG - Intergenic
948533981 2:238632590-238632612 CACAGTCTCCTCTGTCAAATGGG - Intergenic
1169158252 20:3352988-3353010 CTCAGTCTCTTCTGTAAAGTGGG - Intronic
1169158377 20:3354094-3354116 CTCAGTCTCTTCTGTAAAGTGGG - Intronic
1169605091 20:7308806-7308828 CTCAGTCTGTTCTGCCACATTGG + Intergenic
1171518337 20:25757274-25757296 CTCAGTGTCCTCTGCATAGTGGG + Intergenic
1172128245 20:32638316-32638338 CCCAGCCTCATCTGCAAAATGGG - Intergenic
1172131750 20:32660570-32660592 CACTGTCTCCTCTGTAAAATAGG - Intergenic
1172590705 20:36115951-36115973 CTCAGTTTCCCCTGGAAAATGGG - Intronic
1173110876 20:40189023-40189045 TTTAGTCTTCTCTGTGAAATGGG - Intergenic
1173533903 20:43794186-43794208 CTCATTCTTGTCTGCAATATGGG - Intergenic
1174177413 20:48653672-48653694 CTTAGTTTCTTCTGCAAAATGGG - Intronic
1174468134 20:50732706-50732728 CTCAGTCTTCTCAGAGAATTGGG - Intronic
1174755742 20:53156641-53156663 CTCAGTCGTCTCTGAATCATGGG - Intronic
1174999029 20:55606060-55606082 TTCTTTCTCCTCTGCAAAATGGG + Intergenic
1175159400 20:56996681-56996703 CTCAGTTTCCTCATCAAAATTGG - Intergenic
1176652495 21:9563689-9563711 CTCAGTGTCCTCTGCATAGTGGG + Intergenic
1176950045 21:15033731-15033753 CTCAGCCTCATCTGTAAAATTGG - Intronic
1177950794 21:27534161-27534183 CTCATTTTTCTCTGCAAAATGGG + Intergenic
1178896490 21:36562896-36562918 ATCTGGCTCCTCTGCAAAATGGG + Intronic
1179005048 21:37506519-37506541 CTCAGTTTCCACTGTAAAATGGG - Intronic
1179143594 21:38748760-38748782 CTCAGTTTCTTCTGCCAAATGGG - Intergenic
1179468078 21:41591252-41591274 GTCGGTATTTTCTGCAAAATGGG - Intergenic
1179588601 21:42390127-42390149 CTGAGACTTCTCTGCAAAGAGGG - Intronic
1180991548 22:19940405-19940427 CTGAACCTTCTATGCAAAATAGG - Intronic
1181767740 22:25103820-25103842 CTCACTGGCCTCTGCAAAATGGG + Intronic
1181768531 22:25109610-25109632 CTCAGTCTCCTCTGTCAAATGGG + Intronic
1182023143 22:27097987-27098009 CTCGGTCTTCTCTGTAAACTGGG - Intergenic
1182551325 22:31102360-31102382 TTCAATCCTCTCTACAAAATGGG - Intronic
1183909546 22:41068141-41068163 CTCAGTCTTCTCAGCAACCAGGG - Intergenic
1184101959 22:42345430-42345452 CTGTTTCTTCTCTGTAAAATGGG - Intergenic
949596499 3:5553511-5553533 ATCAGTCTTGTCACCAAAATGGG + Intergenic
949938357 3:9134930-9134952 CTCAGTTTCCTCTGTCAAATGGG + Intronic
950102746 3:10368093-10368115 CTCAGTTTACTCTGAGAAATGGG - Intronic
950289217 3:11770199-11770221 CTCCGTCTCTTCTGCAAAATTGG + Intergenic
950652976 3:14419149-14419171 CTCAGCCTTTTCTATAAAATGGG - Intronic
951912345 3:27764661-27764683 CTCATTATTCTTAGCAAAATTGG - Intergenic
951981448 3:28571610-28571632 CTCAACCTTGTCTGCACAATTGG + Intergenic
952531342 3:34265272-34265294 CTCCCTCTTCTCCGGAAAATTGG + Intergenic
953342225 3:42144417-42144439 ATCAGTCTCATCTGCTAAATGGG - Intronic
953719482 3:45343011-45343033 CTCAGTTGCCTCTGTAAAATGGG + Intergenic
954526769 3:51278897-51278919 CTCATTTTTATCTGAAAAATGGG - Intronic
954603098 3:51887453-51887475 CATAATCTTTTCTGCAAAATAGG - Intergenic
954610239 3:51941345-51941367 CTCAGTCTTCCGTGCACCATGGG + Intronic
955035064 3:55259689-55259711 TTCAGTCTTGTCTGTAAAATGGG - Intergenic
956700017 3:71950691-71950713 CTCAGTTTTATTTACAAAATGGG + Intergenic
956725408 3:72152680-72152702 CCCAGCCTTCCCTGGAAAATGGG + Intergenic
956793582 3:72699141-72699163 CAGAGTCTTCTCTGCCTAATTGG + Intergenic
957236853 3:77604105-77604127 CTCCCTCTTCCCTTCAAAATGGG + Intronic
958872700 3:99579920-99579942 CTCAGGCTCATCTGTAAAATGGG - Intergenic
960045457 3:113193179-113193201 CTCAGTCTTCTCTCCTAAGATGG + Intergenic
960938488 3:122918316-122918338 CCCAGGCTTCACTGCAAATTAGG + Intronic
960985397 3:123276625-123276647 ATCAGTCGTCTCAGCACAATTGG + Intergenic
961018931 3:123487852-123487874 CTCTGTTTTCTCTGTGAAATTGG + Intergenic
961124451 3:124403877-124403899 TCCAGTGTTCTCTGCAAACTAGG - Intronic
962436422 3:135371359-135371381 CTCAGTGTTCCCTGTGAAATAGG - Intergenic
962527178 3:136247357-136247379 CTCAGTTTCCTCTGTAAAAGTGG - Intergenic
963346071 3:144097868-144097890 CTCATTCTCTACTGCAAAATGGG - Intergenic
963920849 3:150903281-150903303 CTCTATCATCTCTTCAAAATTGG - Exonic
964405900 3:156349058-156349080 CTCAGTTTCCTCTGTAAAGTAGG - Intronic
965016520 3:163165515-163165537 CTCAATCTATTCTGAAAAATAGG - Intergenic
965777742 3:172250690-172250712 TTCAGTATTCTCTGTAATATAGG + Intronic
965823567 3:172708874-172708896 CTGAGTTTTCCCTGTAAAATAGG - Intronic
966203433 3:177380451-177380473 CTCAGTCTGCTTTGCTAACTTGG - Intergenic
966927790 3:184656811-184656833 CCCAGTCTTCCCTGCAGCATGGG + Intronic
968913602 4:3487648-3487670 CTCACCCTCGTCTGCAAAATGGG - Intronic
969223154 4:5774494-5774516 CTCAGTCTTATCTGTCAAAGGGG - Intronic
970017812 4:11532301-11532323 CTCAGTGTTCTCAACAATATGGG - Intergenic
970482927 4:16495943-16495965 TTCTGTCTTATTTGCAAAATGGG + Intergenic
970553271 4:17205915-17205937 CTCAGTTACCACTGCAAAATGGG - Intergenic
970714365 4:18904563-18904585 GCCAGTGTTCTCTGTAAAATAGG - Intergenic
971269917 4:25132971-25132993 CTCAATTTTATCTGCAAAATGGG + Intronic
971446673 4:26757680-26757702 CTCTATTTTCCCTGCAAAATAGG - Intergenic
971830254 4:31683433-31683455 CTCAGACTTATTTGTAAAATTGG + Intergenic
972071952 4:35032180-35032202 TTCTGTATTCTCTTCAAAATAGG - Intergenic
973147317 4:46843392-46843414 CTCAGTCTTTTCTGTAAAAGAGG - Intronic
975430305 4:74282137-74282159 CCCAGTCTTCTCTTTACAATAGG + Intronic
975692652 4:76981044-76981066 CCCAGACTTCTCAGCAAGATCGG - Intronic
976528564 4:86122174-86122196 CTCATTCCTCTCTGCAAACAGGG - Intronic
977066720 4:92326734-92326756 CTTTATCTCCTCTGCAAAATGGG - Intronic
977147797 4:93467327-93467349 GTCATTGTTCTCAGCAAAATCGG - Intronic
978469157 4:109043112-109043134 CTCACCCTTCTCTGTAAAATAGG + Intronic
978880830 4:113700708-113700730 CTCTGTTTTCTCTGCAGAAAAGG + Intronic
979857854 4:125656665-125656687 CTCAGTTTTCTCTGTAAAGAAGG + Intergenic
982378054 4:154716384-154716406 CTTGGATTTCTCTGCAAAATTGG + Intronic
982697892 4:158624303-158624325 CTCAGTTTTCTCTGTGAAATAGG + Intronic
983724399 4:170902465-170902487 CTCATTCTTTTTTTCAAAATGGG - Intergenic
983986692 4:174068053-174068075 CTAAGTCTTCTCTGAAAAATTGG + Intergenic
984767185 4:183408592-183408614 CTCAACCTCCTCTGCTAAATGGG + Intergenic
984955004 4:185036599-185036621 CTCAGTCTGGTCTGAAAATTAGG - Intergenic
985070906 4:186165849-186165871 CTTAGTGTTCTCTGTAAAAGGGG + Intronic
986377996 5:7152122-7152144 CTCAGTCTTCTCATCAACAAGGG - Intergenic
986957927 5:13177884-13177906 CTCATTCTGCTCCCCAAAATAGG - Intergenic
987122050 5:14776936-14776958 ATCAGTCTTCTCTACACAATGGG + Intronic
988373729 5:30406247-30406269 TTCAGTTTTCTCTGCGAAGTAGG + Intergenic
988947460 5:36220434-36220456 CTCAGCCTTTTCTTCAAGATTGG - Intronic
989704430 5:44311537-44311559 CTCAATTTTATTTGCAAAATGGG + Intronic
990106290 5:52266582-52266604 CTCAGTCTACCCTGAAACATTGG + Intergenic
990852323 5:60220557-60220579 CTCAGTCTTGGCTGCACAATAGG - Intronic
990885418 5:60586082-60586104 AGCTGTCTTCTCTGCAATATGGG - Intergenic
993177745 5:84509706-84509728 CTAACTCTGCTGTGCAAAATGGG - Intergenic
995335493 5:110994210-110994232 CTCAGTTTACTCTGGAAAATTGG - Intergenic
995866092 5:116692795-116692817 CATTGCCTTCTCTGCAAAATGGG - Intergenic
995999509 5:118341792-118341814 TTCAGTTTTCTCAGGAAAATAGG + Intergenic
996924779 5:128811580-128811602 CACATTCTTCTCAGCTAAATGGG + Intronic
998301585 5:141026944-141026966 CCCATTCTTCTCTGCCACATTGG - Intergenic
998924030 5:147102794-147102816 GTCAGTCTCCTCTGAAGAATAGG - Intergenic
999244450 5:150146422-150146444 ATCATTCTCCTCTGTAAAATGGG - Intronic
999416368 5:151399960-151399982 CTCACTCTCATCTGTAAAATGGG - Intergenic
1000458295 5:161480465-161480487 TGCAGTCTCCTCTGCAAACTGGG + Intronic
1000504290 5:162094856-162094878 ATCAGTCTTCTCTGAAAAATAGG + Intronic
1000857339 5:166415543-166415565 TTCAATCCTTTCTGCAAAATTGG + Intergenic
1001787865 5:174429020-174429042 CTCAGTCTCCTCTGGAGAACAGG - Intergenic
1003732169 6:8837140-8837162 TTCTGTCTTCCCTGCAAAACAGG - Intergenic
1005594345 6:27364452-27364474 CTCTGTCTCATCTACAAAATGGG + Intergenic
1006884295 6:37367815-37367837 CTCAGTTTTGTCTGCAGAACAGG - Intronic
1007914928 6:45552564-45552586 TTCACTCCTCTCTGCAACATGGG + Intronic
1007949530 6:45859132-45859154 ATCAGTGTTCTATGGAAAATGGG - Intergenic
1008205960 6:48657088-48657110 CTCACTCTCATTTGCAAAATGGG + Intergenic
1008438931 6:51510271-51510293 CTCATTCTCTTCTGCAAAATGGG - Intergenic
1008486549 6:52042181-52042203 TTCACTCTTCTAGGCAAAATAGG + Intronic
1009383934 6:63066805-63066827 CTCACTCTTATCTGTAAAATAGG - Intergenic
1009710887 6:67318567-67318589 ATTAGGCTTCTTTGCAAAATGGG - Intergenic
1011803305 6:91043082-91043104 CTCAGTCTTCTCTAAAAAGGGGG - Intergenic
1011837110 6:91446116-91446138 CTCAGTCTTATCTGTATAAACGG - Intergenic
1011880982 6:92026419-92026441 CTCAGTTTTCTCAGTTAAATAGG - Intergenic
1013351269 6:109308094-109308116 CTCAGTTCTCTCTGCAACAATGG - Intergenic
1013792409 6:113852661-113852683 CTCAGTCTTCTTTGCCATCTTGG + Intergenic
1013799160 6:113920818-113920840 GGTATTCTTCTCTGCAAAATTGG - Intergenic
1014726797 6:124981007-124981029 CTCAGTTTTCTCTGCATATCTGG + Intronic
1015245239 6:131067185-131067207 CTGCGTATTCCCTGCAAAATAGG - Intergenic
1015306978 6:131720314-131720336 TTCAGTCTTCTCTTTAAAACTGG - Exonic
1015542657 6:134331531-134331553 CTCAGACTTCTCTGGAAACTAGG - Intergenic
1015555431 6:134456468-134456490 CCCTCTGTTCTCTGCAAAATGGG + Intergenic
1015747687 6:136527554-136527576 CTCCGTTTTCTCTGTAAAATTGG + Intronic
1016277266 6:142369423-142369445 CTTTGTCTTATCTGTAAAATGGG - Intronic
1016694093 6:146973020-146973042 CACACTCTTTTCTGCACAATGGG + Intergenic
1016912478 6:149212990-149213012 CTCAGTTTTCTCTGTGAATTAGG - Intergenic
1017918976 6:158855158-158855180 TTTAGTCTTCTCTGAAAGATGGG + Intergenic
1018049005 6:159991368-159991390 CACAGTCATTTTTGCAAAATTGG - Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1019490275 7:1309958-1309980 GTCAGTCTCATCTGTAAAATAGG - Intergenic
1021907172 7:25346122-25346144 TTAACTCTTCTCTTCAAAATTGG - Intergenic
1022482143 7:30751374-30751396 CTCAGTCTTCTCTTTGAAATGGG - Intronic
1022802026 7:33785999-33786021 CTCAGTCTTCTGTCCCAAGTTGG + Intergenic
1022849602 7:34246573-34246595 CTTACTCTTCTCTTCCAAATGGG - Intergenic
1023172159 7:37400092-37400114 CACTGTCTTCACAGCAAAATGGG + Intronic
1023295079 7:38706674-38706696 CTCAGGATTGACTGCAAAATTGG - Intergenic
1023405409 7:39828772-39828794 CTCAGTGTTCTCTTCAAACTAGG - Intergenic
1024387756 7:48773020-48773042 TTCAGTCTTCTCTGCAAAGTGGG - Intergenic
1024607301 7:51032368-51032390 CTCTGTGTTTTCTGCACAATAGG - Intronic
1024618033 7:51132435-51132457 CTCAGTTTCCTCTGTAAAATGGG - Intronic
1026312858 7:69202890-69202912 CTCAGACCTCTCTGCAGAACTGG + Intergenic
1026695281 7:72585943-72585965 CTCATTCTTAACTGCAATATGGG - Intronic
1027222329 7:76221974-76221996 CTCTTTCTTATCTGTAAAATGGG - Intronic
1027568363 7:79828674-79828696 CTCAGACTTCTCTGGAGAATTGG - Intergenic
1027883048 7:83867321-83867343 CACAGTCTCCTCTGCAAAAATGG + Intergenic
1028052272 7:86202845-86202867 CTCACTCTTATCTACAAAACTGG + Intergenic
1028465244 7:91143850-91143872 CTCAGTCTCCTCTGCAAAACGGG - Intronic
1029044128 7:97609491-97609513 CTGTGTCTTCTCTTAAAAATAGG - Intergenic
1033280170 7:140000948-140000970 TTCACTCTACTCTGCAAGATGGG + Intronic
1034584029 7:152072933-152072955 CTGATTCTTCTCTGCGACATCGG + Intronic
1035312730 7:157980163-157980185 CTGAGGTTTCTCTGCAAAACAGG + Intronic
1036652493 8:10654283-10654305 CTCAGTCTCTTCTGCACAAATGG + Intronic
1036934392 8:12987211-12987233 CTCCTTCTTATCTGTAAAATGGG + Intronic
1037446772 8:18973166-18973188 GTCAGTGTTCTTTTCAAAATGGG - Intronic
1037637661 8:20714788-20714810 TTCACTTTTCTCTGTAAAATAGG - Intergenic
1039966474 8:42287698-42287720 CTCAGTTTCTTCTGTAAAATGGG - Intronic
1040671858 8:49701404-49701426 GTCAGTCAACTCTGCCAAATTGG - Intergenic
1040860642 8:51995371-51995393 TTCAGTTTTATCTGTAAAATGGG + Intergenic
1041419337 8:57648743-57648765 CCCATTCTTCTCTGCATAATTGG - Intergenic
1041635443 8:60137813-60137835 TTCAGTCTTCCCTCCAAACTTGG - Intergenic
1041761257 8:61369155-61369177 ATCACTTTTCTCAGCAAAATTGG - Intronic
1042974902 8:74457710-74457732 CTAAGTCTTCTTTGGAAAAAGGG - Intronic
1043083088 8:75791391-75791413 TTCAGTTTTCTATGTAAAATGGG + Intergenic
1044891687 8:96842823-96842845 CTCAGTTTCATCTGTAAAATGGG + Intronic
1045137686 8:99239386-99239408 CACAGTTTACTCGGCAAAATAGG - Intronic
1045507424 8:102788652-102788674 TTTTGTCTTCTGTGCAAAATAGG + Intergenic
1045622594 8:103998754-103998776 CTCAGTATTCTCTGCAGATAAGG - Intronic
1047051113 8:121114472-121114494 CTCATTATTTTCTCCAAAATTGG - Intergenic
1047789084 8:128184261-128184283 CTCAGCTTTCTGTGCAAAATAGG + Intergenic
1047893968 8:129344573-129344595 CTCAATTTCCTCTGTAAAATAGG - Intergenic
1047967339 8:130056167-130056189 CTCACTTTCCTCTGAAAAATAGG - Intronic
1048474254 8:134729254-134729276 CCCAGGCTCCTCTGTAAAATTGG + Intergenic
1048600308 8:135912844-135912866 ATGAGTCTTCTCTCTAAAATGGG + Intergenic
1049027474 8:140004963-140004985 ATCAGTCTTCTTTCCAGAATGGG + Intronic
1049931373 9:460141-460163 TTCAATTTTCTCTGGAAAATGGG - Intronic
1050461136 9:5878423-5878445 CTCATTCTCCTCTGTAAAAGGGG + Intergenic
1050643102 9:7690244-7690266 CTCAGATTTCACTGCAAAAATGG + Intergenic
1051029059 9:12652129-12652151 CTAATTCTTTTCAGCAAAATAGG - Intergenic
1051295532 9:15591414-15591436 TTCAGACTTCTCAGCAAAAATGG + Exonic
1051411908 9:16798456-16798478 GTCATACTTGTCTGCAAAATGGG - Intronic
1051540946 9:18216929-18216951 CTCAGTTTTCTGAGTAAAATGGG + Intergenic
1051563445 9:18469356-18469378 CTCAGTGTTCTCTGTTAAAGGGG + Intergenic
1055277307 9:74633373-74633395 TCCAGGCTTCTCTGCAAGATAGG + Intronic
1056036958 9:82616884-82616906 CTCAGAATCCTCTGCAAAAAGGG - Intergenic
1056367254 9:85917947-85917969 CTCAGGCTACTCTCCAAAATGGG + Intergenic
1057950624 9:99366488-99366510 CTCAGGCTTCTCTGCAGCATGGG - Intergenic
1058881710 9:109291096-109291118 CTCAGTCTCATCTGCGAAATGGG - Intronic
1059017905 9:110542011-110542033 CTGAGTTTTTTCTGTAAAATGGG - Intronic
1059098782 9:111449073-111449095 CTCAGTTTCATCTGTAAAATGGG + Intronic
1059257274 9:112942703-112942725 CTCTGTTTTCTCTGTAAAATGGG - Intergenic
1059306717 9:113359424-113359446 CTCAGTGTTTTCTGTAAAATAGG + Intronic
1059307948 9:113369470-113369492 CTGAGCCTTGTCTGCAAAACGGG - Intronic
1059404623 9:114092238-114092260 CTCAGTCTTATCTCTGAAATGGG - Intronic
1059628031 9:116089039-116089061 CAAAGTCTTCTATGCAACATTGG - Intergenic
1060418688 9:123451864-123451886 CTGAGTCATCTCTGCAATAGAGG + Intronic
1060609164 9:124945881-124945903 CTCAGTCTTTCCTGGATAATGGG - Intronic
1060880199 9:127112636-127112658 CTGAGTCTTTTCTGTGAAATGGG + Intronic
1061009661 9:127947551-127947573 CTCAGTGTTCTTTGGAAAATGGG - Intronic
1061916538 9:133758309-133758331 GTCAGTCTCCTCTGCACAATGGG + Intergenic
1203630226 Un_KI270750v1:67230-67252 CTCAGTGTCCTCTGCATAGTGGG + Intergenic
1187215386 X:17270978-17271000 CTCAGTCTTGGCTGCACATTGGG - Intergenic
1187392986 X:18897725-18897747 CTCAGTCTCATCTGCACAGTGGG + Intronic
1188633019 X:32392122-32392144 CTCAATCCACTCTGCAAACTAGG - Intronic
1189061605 X:37759402-37759424 GTCAGTGTTCTCTGAAAAATGGG + Intronic
1189533983 X:41917259-41917281 CTCAGTGTTCTCTGTAAAATGGG + Intronic
1190394236 X:49963640-49963662 ATCAGCCTTCCCTGCAAAAGAGG + Intronic
1191848758 X:65570156-65570178 TACAGTCTCCTCTGCAAGATAGG + Intergenic
1192471272 X:71400868-71400890 CTCAGTTTCATCTGTAAAATGGG - Intronic
1193416012 X:81224965-81224987 CTCAGTCTTTTCTAAAAAAAAGG + Intronic
1193427811 X:81360994-81361016 CTTTGTTTTCTCTGTAAAATGGG + Intergenic
1194455376 X:94096440-94096462 ATCAGGCTTCTCTCCATAATAGG - Intergenic
1195609544 X:106850373-106850395 CTCAGTTTCCTCTGTAAAATAGG - Intronic
1195924141 X:110008761-110008783 CTCAGTCTTCTCTGTGAAACGGG + Intronic
1196057027 X:111366984-111367006 CTCAGTCTTCTCTTTGAATTGGG - Intronic
1196121742 X:112058665-112058687 CTTAGTATCCTCTGTAAAATGGG - Intronic
1196207140 X:112953511-112953533 CTCAGTTTTCTCCTCAAAACTGG - Intergenic
1196350119 X:114719677-114719699 CTCATTCTTCTCAATAAAATTGG + Intronic
1196687422 X:118523817-118523839 TTCAGTCCCCCCTGCAAAATGGG - Intronic
1197214969 X:123859434-123859456 CTCAGTTTCCTTTGTAAAATGGG + Intergenic
1197898490 X:131342692-131342714 CTGAGTCTTCTCTGTAAACAGGG + Intronic
1198175219 X:134148168-134148190 TTCAGTTTTCTCTGTAAAGTAGG - Intergenic
1198450625 X:136763989-136764011 GACAGTCTTCTCAGCAAAATTGG - Intronic
1198558491 X:137822492-137822514 ATCAATCTTCTCTTGAAAATTGG - Intergenic
1198661343 X:138971235-138971257 CTCAGTTTCCTCTGTTAAATGGG + Intronic
1198686622 X:139234416-139234438 CTCAGCCTCACCTGCAAAATAGG - Intergenic
1198815540 X:140586087-140586109 CTCAGTTTCCTCAGTAAAATGGG - Intergenic
1199091018 X:143692471-143692493 ATCAGGTTTCTCTGCAAAAAAGG + Intergenic
1199610003 X:149604985-149605007 CTCAGTCTTCTCTCCCGACTAGG + Intronic
1199938902 X:152605098-152605120 CCCAGTCACCTCTGCAAAAATGG - Intergenic
1201668083 Y:16482281-16482303 CTTAGTATTTTGTGCAAAATAGG + Intergenic