ID: 907844219

View in Genome Browser
Species Human (GRCh38)
Location 1:58189413-58189435
Sequence GAATTTAAGTGGTTTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907844219 Original CRISPR GAATTTAAGTGGTTTGTGGA AGG Intronic
902769643 1:18638024-18638046 GACTTTTTGTGGGTTGTGGAGGG + Intronic
903915225 1:26758976-26758998 GTACCCAAGTGGTTTGTGGAAGG + Intronic
905635723 1:39550552-39550574 GCATTTAAGGGTTTTGTGGTAGG + Intergenic
907197574 1:52699090-52699112 GAAATTAAGTAGTTTGTCCAAGG + Intergenic
907546359 1:55263241-55263263 GAAAGTAAGTGGTTTCTGGCTGG + Intergenic
907844219 1:58189413-58189435 GAATTTAAGTGGTTTGTGGAAGG + Intronic
909809456 1:79913387-79913409 AAGTTTAAGTGGTTTGTCCAAGG - Intergenic
910261801 1:85300119-85300141 GAATTAAAGGAGTTGGTGGATGG + Intergenic
910999100 1:93143823-93143845 GAATTTAATTGGTTTTAGTAGGG + Intergenic
911195955 1:94995923-94995945 GAAATTAGGAGGTTTTTGGAGGG + Intronic
911432253 1:97805853-97805875 GAATTCAAGAGGTTTGTGGGAGG + Intronic
912906958 1:113717846-113717868 GAATTCCAGTGGGTTGTGGGAGG - Intronic
913475558 1:119233654-119233676 GAATTTTAGAGGATTGTAGATGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914462137 1:147894924-147894946 GAATTTAAGTGAAATGTAGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915518870 1:156429865-156429887 GTGATTAAGTGGTGTGTGGAGGG + Intronic
916933786 1:169606647-169606669 GAGTTTACCTGGTTTGTGGCAGG + Intronic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917278596 1:173357460-173357482 GAATTTAAATGATTTGTCCAAGG + Intergenic
917806873 1:178621730-178621752 GAAGTTAAGTGATTTGTCCAAGG + Intergenic
919704974 1:200668001-200668023 GAAATTAAGTGGTTTGGGCTGGG + Intronic
920929752 1:210376345-210376367 GAATGTAAGGGGATTGTGAATGG - Intronic
921118596 1:212117493-212117515 GAATTTAAGTGATTTGCCCATGG + Intergenic
921788560 1:219263087-219263109 GAATTTATGTGTTTTGTGTTTGG + Intergenic
921865669 1:220085426-220085448 GAATTTAAGTGGTTTTCTCAAGG - Intronic
922175883 1:223197254-223197276 AAGTTTAAGTGGCTTGTTGAAGG + Intergenic
923757930 1:236810502-236810524 GGAATTAAGAGGTTTGTGGCAGG + Exonic
1062866832 10:862990-863012 GAAAATAAGTTGTTTGGGGAAGG - Intronic
1064690818 10:17916912-17916934 AAATCTAGGTGGTTTGTGAAGGG + Intergenic
1066313211 10:34218489-34218511 GAATTGAGTAGGTTTGTGGAGGG - Intronic
1067400342 10:45967604-45967626 GATTATAAGTATTTTGTGGAAGG - Intergenic
1067749234 10:48959112-48959134 GAAGTGAAGTGGCTTGTGCAAGG + Intronic
1067868666 10:49936890-49936912 GATTATAAGTATTTTGTGGAAGG - Intronic
1068083884 10:52350251-52350273 GAATTTAAATGCTTTGAGCAAGG - Intergenic
1068110931 10:52680333-52680355 GAGTTTGAGTGGTATATGGAGGG - Intergenic
1068787841 10:60996381-60996403 GAATTTAGCTGGATTGTGGGTGG - Intronic
1069062032 10:63904256-63904278 GAATTAAAGTAATCTGTGGATGG + Intergenic
1069880733 10:71591262-71591284 GATTTTAAGTGGTGCATGGATGG + Intronic
1071031271 10:81184596-81184618 GAAGGTCAGTGGTTTGGGGATGG + Intergenic
1072249616 10:93571327-93571349 GGATTTACGTGATTTGTGGCAGG - Intronic
1072756700 10:98026233-98026255 GAGGTTAAGTGGTTTGTTTAAGG + Intronic
1073660242 10:105467760-105467782 GAAGTTAAGTTCTTTGAGGAAGG + Intergenic
1073806812 10:107107423-107107445 GTGTTTCAGTGCTTTGTGGAAGG + Intronic
1074243041 10:111658086-111658108 GAATTCAGGAGGTTTCTGGAAGG + Intergenic
1075934256 10:126326235-126326257 TAATTTAAATGGTTTGAGGCAGG - Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079535261 11:21506591-21506613 CAATTTATGTGGTTTATGGTGGG + Intronic
1079661716 11:23045755-23045777 GGGTATAAGTGGTTTGGGGATGG + Intergenic
1080749299 11:35138312-35138334 GGACCTAAGTGGTTAGTGGATGG + Intergenic
1085064423 11:73480743-73480765 GAAGTTAAGTGATTTGTTCAAGG + Intronic
1085617772 11:78014606-78014628 AAAATTCAGTGGTTTGTGAAAGG + Intergenic
1085837865 11:79975594-79975616 GAAGTTTAGTGACTTGTGGAAGG + Intergenic
1086594689 11:88556716-88556738 GAATTTAAGTGCTTAGTCTAGGG + Intronic
1089363308 11:117905277-117905299 GGATTTAGGTGGCTTGGGGAGGG - Intronic
1090045690 11:123330848-123330870 GAAGTTAAGAGGTCTGTGGGAGG - Intergenic
1090540367 11:127695999-127696021 AGATTTAAGTGATTTGTGCAAGG + Intergenic
1090870508 11:130742115-130742137 GGATTTAACTGGTTTATGAATGG - Intergenic
1091427332 12:402467-402489 GAAATTATGAGGGTTGTGGAGGG + Intronic
1091702313 12:2671960-2671982 GATTTTAACAAGTTTGTGGAGGG - Intronic
1092121544 12:6047538-6047560 GAATTTCAGTGGTATGTTGGAGG - Intronic
1092222150 12:6721797-6721819 GAAGTTAAATAGTTTGTTGAAGG - Intergenic
1094718012 12:33033031-33033053 GAATTAGTGTGGTTTTTGGAAGG + Intergenic
1095194020 12:39291124-39291146 GAATTTATATGTTTGGTGGAAGG + Intergenic
1095595098 12:43949965-43949987 GAATTCAAGTTATTTGGGGAGGG - Intronic
1095689917 12:45076030-45076052 GAATTTGAGTGTTATGTGGGAGG + Intergenic
1096875607 12:54627976-54627998 ACATTTAAGGGCTTTGTGGAAGG + Intergenic
1099113562 12:78594149-78594171 AAGCTTAAGTGGTTTATGGAAGG - Intergenic
1101233723 12:102767304-102767326 GAGTTTAAGTGATTTGTGTAAGG - Intergenic
1101280395 12:103248738-103248760 GAGGTCAAGTGGTTTGTGCAAGG - Intronic
1104087441 12:125489286-125489308 GAAGTTAAGTGATTTGTCCAAGG + Intronic
1108000344 13:45900404-45900426 AAATTTATGAGGTTTGCGGAGGG - Intergenic
1108860236 13:54848966-54848988 GAATTTAATTGTTTAGTTGATGG - Intergenic
1109088662 13:58010620-58010642 GAATTTAAGTTGGTGGAGGAAGG - Intergenic
1110171633 13:72507686-72507708 TATTTTAAGTTGTATGTGGAGGG - Intergenic
1110843916 13:80172431-80172453 TAATTTAATTGGTTTGGGGTGGG + Intergenic
1111853612 13:93607934-93607956 GAATTTGAGTTGTATTTGGAAGG - Intronic
1112107011 13:96252190-96252212 ATATTTAAGTGGTTTGAGGTTGG + Intronic
1113467261 13:110521004-110521026 GAACTGACGTGGTTTCTGGAAGG + Intergenic
1115002172 14:28436097-28436119 GAAATTAAGTGGTACATGGATGG - Intergenic
1115195677 14:30796567-30796589 GAAGTTAAGAGGTTTTTGGGGGG - Intergenic
1117424825 14:55582723-55582745 GAACTTAAGTGGTTCTAGGAAGG + Intronic
1117620164 14:57577448-57577470 GAATGTTGGTGGTTGGTGGATGG - Intronic
1117897603 14:60504253-60504275 GAATTTAAGGTATTTGTTGAAGG + Intronic
1118026502 14:61774043-61774065 GAAGTTAAGTAGTTTGTATAAGG + Intronic
1118116618 14:62784474-62784496 GGATTTAAGTGGTGTGTTTATGG + Intronic
1118473630 14:66097674-66097696 GAATGAAAGAGGTTTGTGGAAGG + Intergenic
1118833656 14:69459467-69459489 AATTTTAAGTGATTTTTGGATGG + Exonic
1119092972 14:71801586-71801608 GACTGTAAGTGGTGTGTGGTGGG + Intergenic
1119753747 14:77098943-77098965 GGAGTTAAGTGGTTAGTGGGTGG + Intronic
1120779039 14:88469348-88469370 GAATACAAGTGTTTTGGGGAGGG - Intronic
1127653076 15:61028291-61028313 GGAGTTGAGTGGTTTATGGAGGG + Intronic
1130169596 15:81497708-81497730 GAATTTCAGATGTTTGGGGAAGG + Intergenic
1133436588 16:5785264-5785286 GAACTTAAATGGTATGTGGCAGG + Intergenic
1133632823 16:7638104-7638126 GAACTTAAGTGGGGGGTGGAAGG - Intronic
1133853773 16:9530322-9530344 GAACTTGAGTGGTTTCTGGATGG - Intergenic
1135050742 16:19191006-19191028 GAGTTCATGTGGTTTGGGGAAGG + Intronic
1135146972 16:19971136-19971158 GAAGTTAAATGGTTTGTTCAAGG - Intergenic
1136379597 16:29886841-29886863 GAAGTTAAGTGATTTGTCTAAGG + Intronic
1137279451 16:46963256-46963278 GAATTTAGGTGATTACTGGAGGG + Intronic
1137563074 16:49515505-49515527 GAAGTTAAGCGGTTTGCCGAGGG - Intronic
1138962380 16:62042798-62042820 GAAGTTAAGTGATTTGTTCAAGG + Intergenic
1139069761 16:63365784-63365806 GAAGTCAAGTGGCTTGTGCAAGG - Intergenic
1140822477 16:78675951-78675973 TGATTTAAATGGTTTGTGGTGGG - Intronic
1140969396 16:79998241-79998263 TAATTCAAGTGGTTTGGGCATGG + Intergenic
1141233596 16:82194764-82194786 GAATTTAATTGGTTGCTGTATGG + Intergenic
1141609817 16:85174940-85174962 GAATTTAGGTGGGATGAGGAGGG + Intronic
1142222535 16:88862608-88862630 GAATTTAAGTAGTCTGGGGCTGG - Exonic
1142500542 17:330434-330456 GATTTAAAGTTGTTTGAGGACGG - Intronic
1143056458 17:4165845-4165867 GAATTGAAGTGGTTGGTACATGG - Exonic
1143141207 17:4742770-4742792 GAAGTAAAGTGGTTTGTTTAAGG - Intronic
1144395325 17:14837569-14837591 TGATTTAACTGGTTTGTGGTGGG - Intergenic
1144770601 17:17757402-17757424 GAATTGAACTGGTCTGTAGAAGG - Intronic
1145086494 17:19946428-19946450 GAAGTTAAGTGCTTTGTCCAGGG - Intronic
1146719700 17:35115255-35115277 GCATTGAAGTGGTGTGTGAATGG - Intronic
1148006600 17:44436239-44436261 GAAGTTAAGTGATTTGCCGAGGG - Intronic
1149318270 17:55458974-55458996 TAATTCAAGTGGTCTGTAGATGG + Intergenic
1149899776 17:60464422-60464444 GAGTTTAAGGGGTTGGAGGAAGG - Intronic
1150183529 17:63154238-63154260 GAATTCAAGTGATTTGTCTAGGG + Intronic
1152495939 17:80671553-80671575 GAACTTAAGTCGGTTGGGGAAGG + Intronic
1154057701 18:11027158-11027180 GAATTCAAGGGGCTTGGGGATGG + Intronic
1155918525 18:31579406-31579428 GAATTCAACTGGTTTTTGAATGG + Intergenic
1157516107 18:48312577-48312599 GAATTTAAGTAGCTTGTCCAAGG - Intronic
1166045426 19:40227044-40227066 GAAGTTAAGTGTTGTGTGGCCGG + Intergenic
1167706560 19:51084532-51084554 GAATTTAAGGGGCTAGGGGAGGG - Intergenic
1167708115 19:51093833-51093855 GAATTCCAGTGCTTTATGGAGGG + Intergenic
924982043 2:232371-232393 GATTTTCAGATGTTTGTGGAAGG - Intronic
926764974 2:16316380-16316402 TGATTTAATTGGTTTGTGGTGGG - Intergenic
926999425 2:18777408-18777430 GCTTTTAAGTGGTTTGAGGCTGG - Intergenic
927541793 2:23918847-23918869 GAGGTTAAGTGGCCTGTGGAAGG - Intronic
928266642 2:29817633-29817655 GAATTTAAATGGTTTGCCCAAGG + Intronic
928436729 2:31259304-31259326 GAAGTCAAGTGATTTGTCGAAGG - Intronic
930124851 2:47787598-47787620 TAATTTAAGGTGTTTTTGGAGGG + Intronic
930734564 2:54763583-54763605 GCATTTGTGTGGTTTTTGGATGG + Intronic
932646091 2:73503908-73503930 GTAATTAAGTGTTTTATGGAAGG + Intronic
932906018 2:75752365-75752387 GAGCTTGAGTGGTTTGGGGATGG + Intergenic
932940176 2:76154931-76154953 GAAATTAAGTGACTTGTTGATGG + Intergenic
933364363 2:81330616-81330638 GAAGTGAAGTGTTTTGTAGAGGG - Intergenic
936654050 2:114463806-114463828 GATTTGAAGGGGTTTGGGGAGGG - Intronic
937013379 2:118581761-118581783 GACTTGAAGTGGTTTGGGGCGGG - Intergenic
939568671 2:143814422-143814444 GAAATTAAGTAGTTTGTCTAAGG - Intergenic
940664506 2:156591524-156591546 ATACTTAAGTGCTTTGTGGATGG + Intronic
942753002 2:179309020-179309042 TCACTTAAGTGGTTTGTGCAAGG - Intergenic
943686843 2:190827471-190827493 GACTGTAATTGGTTTGTGGTTGG - Intergenic
943992219 2:194711127-194711149 GTATTTCAGTGGATTGTGAAAGG + Intergenic
944870954 2:203911347-203911369 GAATGTAAGGGGTTGGAGGAGGG + Intergenic
946524977 2:220508607-220508629 GAAGTTAAATGGTTTATGCAGGG + Intergenic
946538769 2:220660683-220660705 GCATTTACGTGGTTAGTGGTTGG - Intergenic
946991148 2:225331066-225331088 TGATTTAATTGGTTTGTGGTGGG + Intergenic
947268824 2:228309972-228309994 AAATTTAAGTGACTTGTGCAGGG + Intergenic
947708635 2:232296390-232296412 TAATTTAAGTGGTTTTTGTCAGG + Intronic
947767002 2:232644263-232644285 GAATAAAAGAGGTTTGGGGAGGG - Intronic
1169398074 20:5253211-5253233 GAATTGTTGTGGTTTGTGGGGGG + Intergenic
1169567181 20:6868000-6868022 GAAATGAAGTAGTTTCTGGAAGG + Intergenic
1170237525 20:14123718-14123740 GAATGTCAGTGGTTTCTGGCAGG + Intronic
1172470450 20:35189887-35189909 GAATTGAAGAGTTTTGAGGAAGG + Intergenic
1173571614 20:44080499-44080521 GAATTTAAATGCTTTTTGGCAGG - Intergenic
1174091424 20:48051734-48051756 GACTTTAAGGGGTTAGAGGAGGG + Intergenic
1174181962 20:48680591-48680613 GAGTCTAAGTGGGTTGTGCAGGG - Intronic
1174314461 20:49687238-49687260 GAAGTTAAGTGATTTGTCTAAGG - Intronic
1174711295 20:52708092-52708114 AAATTCAAGTGATTTGTGTAGGG - Intergenic
1177163699 21:17576329-17576351 GAGGTTAAGTGGTTTGTCTAAGG - Intronic
1177237386 21:18410132-18410154 CAATTTAAGTGGTTAGAGAAAGG + Intronic
1181800884 22:25347102-25347124 GAATTTGAGTGTGGTGTGGATGG + Intergenic
1181909244 22:26225316-26225338 GACTCTTAGTGTTTTGTGGATGG - Intronic
1182938174 22:34246703-34246725 GAAGTTAAATTGTTTGTTGAGGG - Intergenic
1184079528 22:42209693-42209715 GAATCTACCTGGTTTGTGGCAGG - Exonic
949279612 3:2330633-2330655 GAATCTAAGTAATTTGTGGAAGG + Intronic
949496100 3:4633688-4633710 AAATTTATGTGATTTGCGGATGG - Intronic
949556452 3:5157543-5157565 TAACTTAAGTGCTTTGGGGAGGG - Intronic
949859560 3:8493088-8493110 GAAGTTAAGTAGTTTTTGCAAGG - Intergenic
950824268 3:15800149-15800171 GAATTTAAGTGGTTTGTCCAAGG - Intronic
951649236 3:24931045-24931067 GAAGTTAAGTGATTTGTTCAAGG + Intergenic
952412436 3:33061728-33061750 GAAGTTAAGTTGTGGGTGGAAGG + Intronic
952413532 3:33070286-33070308 GAATTGAGGTGCTCTGTGGAAGG + Intronic
953994822 3:47511900-47511922 GAAGTTAAGGCATTTGTGGAAGG - Intronic
955021709 3:55127958-55127980 CAATTTAATTGGTTTAGGGAAGG - Intergenic
955238013 3:57156917-57156939 GAATTTCAATGGTTCGTGGGAGG - Intronic
955343816 3:58146297-58146319 GAATTTAAGTGTGTTTTGGTTGG + Intronic
955881876 3:63555302-63555324 GAATTTATGAGGTTCGTGAATGG + Intronic
956309564 3:67864028-67864050 AAATTTAAGTGGTTTTTCCAAGG - Intergenic
956828469 3:73020977-73020999 GAATTTTAGTGGTGTGGGGCAGG + Intronic
956917445 3:73887228-73887250 GAAATGAAGTGATTGGTGGAGGG - Intergenic
957211660 3:77266779-77266801 GAAATTAAGTGATTTATGTAAGG + Intronic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
957831154 3:85521767-85521789 GAATTTAAGAGATTTACGGAAGG + Intronic
958859228 3:99425299-99425321 AATTTTAAGTGGTATTTGGAAGG + Intergenic
960026935 3:113020096-113020118 GAAATGAAGAGGTTTGTGCAAGG + Intergenic
960051678 3:113245011-113245033 GAGTCTAAGTGATTTGTAGAAGG - Intronic
960082501 3:113556108-113556130 TAATTTAAGTGATTTGTCCAAGG + Intronic
960153637 3:114275800-114275822 GAATCTTGGTGCTTTGTGGAAGG - Intergenic
960160588 3:114346460-114346482 GAAATTAACTGATTTGTTGAAGG + Intronic
960217940 3:115065762-115065784 GAGGTTAAGTGGTTTGTGCAAGG + Intronic
962514411 3:136136744-136136766 GATTTTAAGTTGTTTTTGGAGGG - Intronic
962954047 3:140247927-140247949 TGATTTAATTGGTTTGTGGTTGG + Intronic
963091096 3:141484878-141484900 TAATTTAAGTGGTATGTAGGAGG + Intergenic
963459208 3:145586569-145586591 GAATTTATGTGCTTTGGGGATGG + Intergenic
965257548 3:166434516-166434538 GACTATCAGAGGTTTGTGGAGGG - Intergenic
965901738 3:173649209-173649231 GAATATGAGTGGTTGCTGGATGG + Intronic
966348036 3:179000671-179000693 AAACTTAATTGGTTTTTGGAAGG + Intergenic
966613828 3:181893607-181893629 GATTTTAAGTTGTTTTTGCAGGG + Intergenic
967775222 3:193379279-193379301 GATTTTAAGTGATTTGTCCAGGG - Intergenic
970890600 4:21039551-21039573 GATTTTAAGTGCTTTGAGGGTGG - Intronic
972150291 4:36081168-36081190 GAATTAAAATGATTTGTGGCAGG - Intronic
973755087 4:54066214-54066236 GAAGTTAAGTGGCTTGTCTAGGG - Intronic
973809116 4:54552963-54552985 GAATTGAAGTGGTTTGCCCAAGG - Intergenic
974744784 4:66057838-66057860 GTGTTCAAGTGATTTGTGGAAGG - Intergenic
974863867 4:67556060-67556082 GAAGTCAAGTGGTTTGTTCAAGG + Intergenic
974928207 4:68327500-68327522 GAATTTAACAGGTTTGAGGTGGG + Intronic
975088551 4:70373054-70373076 GAATAGCAGTGATTTGTGGAAGG - Intronic
976881037 4:89925533-89925555 AAATTTAAGTGGTTTTAGGCTGG + Intronic
977266250 4:94858864-94858886 GAATTTAAGTGGATTTGGAAGGG - Intronic
977464913 4:97371772-97371794 GAATTTAAGTTGCTTGTGGTGGG - Intronic
978273130 4:106915319-106915341 GAATTTAAGGAGTATGTGGCTGG - Intergenic
978653420 4:111036876-111036898 GCATATAAGTGGTTTGTGTTTGG + Intergenic
979957971 4:126979150-126979172 GAACATTAGTGATTTGTGGAAGG - Intergenic
982029301 4:151283415-151283437 GAAGTTAAGTGATTTGTCCAGGG - Intronic
982269769 4:153574446-153574468 GAATCTGAGTGTTATGTGGAAGG + Intronic
983324219 4:166232738-166232760 GAATTAAAGTTATTTGTAGAGGG + Intergenic
983741174 4:171136318-171136340 GCATTTATGTGGTTTTTTGATGG - Intergenic
985993886 5:3585444-3585466 TGAGTTAAGTGGTTTGTCGAAGG - Intergenic
987378916 5:17265569-17265591 GGATTTCAGTGCTTTGTGGCAGG - Intronic
987810593 5:22829850-22829872 GAATAAAAGTTGGTTGTGGATGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990428766 5:55713902-55713924 GAATTTAAGTGCCTTGTACAAGG + Intronic
990711464 5:58585019-58585041 GAAATTAATTTGCTTGTGGATGG + Intronic
990791654 5:59487477-59487499 GAATTTAAGTAGCTTGTCCAAGG - Intronic
990894060 5:60678027-60678049 AAATTTAAGTTGTTTGAGGGAGG - Intronic
991218893 5:64189511-64189533 GTATTCTAGTGCTTTGTGGAAGG + Intronic
992139898 5:73785545-73785567 GAATTGAAGTGGGATGTCGAGGG - Intronic
992416078 5:76552584-76552606 GCATTTTTGTGTTTTGTGGAAGG - Intronic
993385283 5:87254893-87254915 GAATTCAAGAGATCTGTGGAAGG - Intergenic
997335622 5:133107165-133107187 GCATGTAAGTGGTTTCTGTAGGG + Intergenic
997949020 5:138227195-138227217 GAATTTAAATGGCTTGTGAAAGG - Intergenic
998441062 5:142162431-142162453 GAATCCTAGTGTTTTGTGGAAGG - Intergenic
998828044 5:146125634-146125656 AAATTTAAGTGATTTGTCCAAGG + Intronic
998875912 5:146599225-146599247 GGATTTAAGTGTTGGGTGGATGG - Intronic
998981487 5:147707880-147707902 GAATATAAGTGTTTTGAGGCAGG + Intronic
999330544 5:150671141-150671163 GAAATTAAGTGGAGGGTGGATGG - Intronic
999739678 5:154540755-154540777 GAGGTTAAGTGGTTTGTCCAAGG - Intergenic
1000179607 5:158795269-158795291 GAATGTAAGTGATTTGTATATGG - Intronic
1000786591 5:165552233-165552255 TAATTTAAGTGGAATTTGGATGG - Intergenic
1001207922 5:169781397-169781419 GAGGTTAAGTGGTTTGTCCAAGG - Intronic
1002294254 5:178221268-178221290 GAAATCAAGTGGGTTGTGTAAGG - Intronic
1004704890 6:18115615-18115637 GAATTAAAGTGGTTTGTGGTGGG - Intergenic
1004780055 6:18898243-18898265 CACTTGAAATGGTTTGTGGAGGG - Intergenic
1005948907 6:30616727-30616749 GAATTTGGGTGGTTTGGGAAGGG + Exonic
1006661339 6:35648098-35648120 GGATTTAATTGGTCTGTGGTGGG + Intronic
1009485867 6:64220869-64220891 GAGTTTAAGTGTTTTGTCCATGG - Intronic
1012170145 6:96006795-96006817 GTGTTTTAGTGCTTTGTGGAAGG + Intergenic
1013282436 6:108651081-108651103 GAATTTCAGTGAGGTGTGGAGGG + Intronic
1013629227 6:111969325-111969347 GAATTTAATTGGTTTGGTGTGGG - Intergenic
1013685948 6:112583198-112583220 AATTTTCAGTGGTTTGTAGAAGG - Intergenic
1015388362 6:132652015-132652037 GAATTTAAGTAGGTTATAGATGG - Intergenic
1016572944 6:145535420-145535442 TAATTTAATTGGTTTGAGGTGGG + Intronic
1018634216 6:165846669-165846691 TCCTTTAAGCGGTTTGTGGAAGG + Intronic
1021066437 7:16180215-16180237 TGATTTAATTGGTTTGTGGTGGG + Intronic
1021985396 7:26093253-26093275 GAGTTTAAGTGACTTGTTGAAGG - Intergenic
1024466823 7:49720138-49720160 GAATTTAAATAGTTTGTGCAAGG - Intergenic
1025845823 7:65196339-65196361 GAATTTAAGTGGCTTGCCTAAGG - Intergenic
1025896048 7:65702052-65702074 GAATTTAAGTGGCTTGCCTAAGG - Intergenic
1026461276 7:70617364-70617386 GAATATAAGAAGTTTGTGGCCGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026653574 7:72236908-72236930 GAATTTAATTGATGTGTTGAAGG + Intronic
1027331428 7:77099424-77099446 GAATTAAAGTGGTTTGAGATAGG + Intergenic
1027799447 7:82733604-82733626 GAATTTAAATATTTGGTGGAAGG - Intergenic
1028265186 7:88715276-88715298 AAATATTTGTGGTTTGTGGATGG + Intergenic
1029784345 7:102771914-102771936 GAATTAAAGTGGTTTGAGATAGG - Intronic
1030744738 7:113151501-113151523 GCATTTAAGATCTTTGTGGAAGG + Intergenic
1031098363 7:117448172-117448194 GAATTTGTGTGCTTTGGGGAGGG + Intergenic
1031209600 7:118805682-118805704 CAATTTAATTGGTTTGAGGAAGG + Intergenic
1032320588 7:130883092-130883114 GAGTTAAAGTGATTTGTGCAGGG - Intergenic
1032551824 7:132791353-132791375 GAATTTAAATGATCTGTAGAAGG - Intronic
1032610781 7:133410320-133410342 GAAATTAAGAGTTTTGTGCAGGG + Intronic
1033176781 7:139131897-139131919 GAATCTAAGTGGCTTCTGGAAGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1039234573 8:35487903-35487925 GTTTTCTAGTGGTTTGTGGAAGG + Intronic
1041609441 8:59827748-59827770 GAATTAAAGTGGTTTTAGCAGGG + Intergenic
1043107620 8:76134881-76134903 GAATTTAAGTTCTATGTGAATGG + Intergenic
1044068290 8:87724301-87724323 GAATTTAATGTGTTTGGGGAAGG + Intergenic
1044331574 8:90926464-90926486 GAAGTTAAGTGATTTGTCCAAGG + Intronic
1045380424 8:101618556-101618578 GAAATTAAGTGACTTGTGTAAGG + Intronic
1045709517 8:104966721-104966743 TAACTTAATTGGTTAGTGGAAGG + Intronic
1045862265 8:106826790-106826812 GAATATAATTGGTCTGGGGAGGG + Intergenic
1046911878 8:119637345-119637367 GAATTGAAGTGGGGTGTGGCGGG - Intronic
1048316155 8:133363915-133363937 CAATTTAATTTGTTTGTGGTAGG + Intergenic
1050691114 9:8227311-8227333 GAAATGAAGGGGTTTGAGGAAGG + Intergenic
1050890854 9:10822394-10822416 GAATTTAAGTGATTTGCCCAAGG - Intergenic
1052224159 9:26064282-26064304 AAATCTAAGTGGTTTACGGAGGG + Intergenic
1055207446 9:73750095-73750117 GAATCTATGTGGTCTGTGGATGG + Intergenic
1056480466 9:86998615-86998637 GAATTTAAGTAATTTGTTCAAGG + Intergenic
1056812217 9:89773579-89773601 TAATTAAAGTGGGTTGTTGAGGG - Intergenic
1057287737 9:93773883-93773905 CAGTTTTAGTGTTTTGTGGAAGG + Intergenic
1057883903 9:98814204-98814226 CAGTCTATGTGGTTTGTGGAGGG - Intronic
1058178077 9:101761849-101761871 GAAATTAAGTGATTTGTAAAAGG + Intergenic
1058327981 9:103721988-103722010 AAATTTAAGTGGTTTCTAAAAGG - Intergenic
1058488432 9:105467061-105467083 GAATTTAAGTGCCTTGTATAAGG + Intronic
1058552261 9:106127502-106127524 GAATTTACTTGTTTTGTGAAAGG + Intergenic
1059757319 9:117305533-117305555 GAAGTTAAGTGATTTCTGGAAGG - Intronic
1060140722 9:121207736-121207758 GAAGTTAAGTGATTTGTCTAAGG - Intronic
1060652407 9:125339944-125339966 GAAATTAAGTGATTTGTCCATGG + Intronic
1185961762 X:4552454-4552476 ACACTTAAGTGGTCTGTGGATGG - Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1188563276 X:31494397-31494419 GAATCTAAGTTGTATTTGGAAGG + Intronic
1188933073 X:36139221-36139243 GAATTTAATTGGCATCTGGAAGG + Intronic
1189029210 X:37432652-37432674 GAAATGAAGTGGTTGTTGGATGG - Intronic
1189057587 X:37714588-37714610 TATTTTAAGTGGCTTCTGGAAGG - Intronic
1189124611 X:38433199-38433221 AAATTGAAGTGGTATGAGGAGGG - Intronic
1189435885 X:40992336-40992358 TAATTTAAGACGTTTCTGGATGG + Intergenic
1190224036 X:48532062-48532084 GTATTCTAGTGTTTTGTGGAAGG - Intergenic
1191894721 X:65979980-65980002 GGATTGAAATGGTTTTTGGATGG + Intergenic
1193699388 X:84743457-84743479 GCCTTTATGTGGTTTTTGGAGGG - Intergenic
1193774626 X:85626879-85626901 GCCTTTGTGTGGTTTGTGGATGG + Intergenic
1194704669 X:97160845-97160867 GAATTTAAGTGTTTGGTATATGG - Intronic
1195039473 X:101001188-101001210 CAATTTAATTGGTTTGGGGAGGG - Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195776898 X:108416208-108416230 AAAGTTAAATAGTTTGTGGAGGG - Intronic
1195924486 X:110012158-110012180 GCTTTTTAGTGGCTTGTGGATGG + Intronic
1196549034 X:116999080-116999102 GAATGTAAGTGGTTTGAGCATGG - Intergenic
1198894118 X:141431728-141431750 GAGTTTAAGGAATTTGTGGATGG - Intergenic
1198977970 X:142358568-142358590 GAATTGAAGGAGTTTGTGGATGG - Intergenic
1199556859 X:149118800-149118822 GAAGTTAAGTGTTTTGAGGTGGG - Intergenic
1199670263 X:150140980-150141002 GACTTTTAGTGGTTTGTTTAGGG + Intergenic
1202039623 Y:20668327-20668349 AAAGTTGAGTGGTGTGTGGATGG - Intergenic