ID: 907845764

View in Genome Browser
Species Human (GRCh38)
Location 1:58205184-58205206
Sequence CTCAGATGGAAGTCTGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907845764_907845768 -9 Left 907845764 1:58205184-58205206 CCATGGACAGACTTCCATCTGAG 0: 1
1: 0
2: 0
3: 15
4: 149
Right 907845768 1:58205198-58205220 CCATCTGAGTGGGTTCACTCTGG No data
907845764_907845769 5 Left 907845764 1:58205184-58205206 CCATGGACAGACTTCCATCTGAG 0: 1
1: 0
2: 0
3: 15
4: 149
Right 907845769 1:58205212-58205234 TCACTCTGGACAACTCTTTCAGG 0: 1
1: 0
2: 1
3: 13
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907845764 Original CRISPR CTCAGATGGAAGTCTGTCCA TGG (reversed) Intronic
900715860 1:4143176-4143198 CTCAGGTGGAATTCTGCCCCTGG + Intergenic
901611213 1:10499931-10499953 CTCAGATGGAACCTTGTCCAGGG + Intronic
901770426 1:11527599-11527621 CTCAGATGGGTCTCTGCCCAGGG + Intronic
903452799 1:23466002-23466024 CACAGAGGGAGATCTGTCCAAGG + Intronic
904317817 1:29677185-29677207 CTCAGGTTGAAGTCTATCCATGG - Intergenic
905256978 1:36691118-36691140 TCGAGATGGAAGTCTGTGCAGGG - Intergenic
905951892 1:41958876-41958898 AGGAAATGGAAGTCTGTCCAAGG + Intronic
906843230 1:49161752-49161774 TTCACACTGAAGTCTGTCCACGG + Intronic
907845764 1:58205184-58205206 CTCAGATGGAAGTCTGTCCATGG - Intronic
910692087 1:89975284-89975306 CTCAGATGGAGCTCTGCCCAAGG - Intergenic
911583914 1:99668159-99668181 TTCATATGGAAGGCTGACCATGG - Intronic
912747739 1:112259450-112259472 ATCAAATGGAAGCCTTTCCAAGG + Intergenic
914454614 1:147824297-147824319 CTCACATGGCAGGCAGTCCAAGG + Intergenic
917635592 1:176932709-176932731 CCAAGAGGGAATTCTGTCCACGG - Intronic
918571749 1:186002619-186002641 CACAGATGGAATTCAGTCAAGGG - Intronic
920940782 1:210480270-210480292 CTCAGCTTGCAGTCTGTCCGTGG - Intronic
923703064 1:236318271-236318293 CTCACCTGGAATTCTGACCAAGG + Intergenic
1063231019 10:4065667-4065689 CTCAGAGGCCAGCCTGTCCACGG - Intergenic
1066298327 10:34075477-34075499 TCCAGATGGAACTTTGTCCAGGG + Intergenic
1066466788 10:35658827-35658849 CTGAGATCGAAGCCTTTCCATGG + Intergenic
1067542608 10:47166634-47166656 CTCAGAGCGAAGTCTGGCCTTGG + Intergenic
1071002948 10:80851951-80851973 CTGAGATGGAAGGGTCTCCAGGG + Intergenic
1071238698 10:83679794-83679816 CTCAAATGAAATTCTGTTCAAGG - Intergenic
1072294726 10:93998073-93998095 CTCAGTCGGAAGTCTTTCTAGGG + Intronic
1073037904 10:100576978-100577000 ATCAGCTGAAAGCCTGTCCAGGG - Intergenic
1074470487 10:113722164-113722186 CTCAGAAGGATGCCTGTGCAGGG + Intronic
1075092702 10:119452500-119452522 CTCAGATGCAGGTGAGTCCAGGG - Intronic
1075526912 10:123194649-123194671 CTGAGATGAAAATGTGTCCAAGG - Intergenic
1077395018 11:2316377-2316399 CTCAGATGGAAGGGTGACCCGGG + Intronic
1085023744 11:73224674-73224696 CTCAGGGGGAAGGCAGTCCAGGG - Intronic
1088299721 11:108344172-108344194 TTGTGATGGAAGTCTGTACAGGG + Intronic
1089278170 11:117353677-117353699 CTCAAATGTGAGTTTGTCCAGGG + Intronic
1089818814 11:121202284-121202306 CTCAGGAGGAAGCCTGACCAAGG + Intergenic
1090225785 11:125071505-125071527 CTCAGATGACAGTCTGTCTTAGG - Intronic
1094023315 12:25937170-25937192 CTTAGATGGGAGTGAGTCCAGGG + Intergenic
1094392873 12:29971825-29971847 TTCAGATGGAGGGCTGTGCATGG - Intergenic
1095859548 12:46901343-46901365 CTCAGATGGCAGTCTATGAAAGG - Intergenic
1100400686 12:94226465-94226487 CTCACAGGAATGTCTGTCCAGGG + Intronic
1101431683 12:104632398-104632420 CTCTGGTGGAATTCTGTGCAAGG + Intronic
1104350524 12:128041208-128041230 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1104350539 12:128041274-128041296 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1104350590 12:128041490-128041512 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1104350595 12:128041512-128041534 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1104350605 12:128041556-128041578 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1104350637 12:128041688-128041710 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1104350642 12:128041710-128041732 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1104350664 12:128041798-128041820 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1104350669 12:128041820-128041842 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1104350679 12:128041864-128041886 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1104350689 12:128041908-128041930 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1104350704 12:128041974-128041996 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1104350714 12:128042018-128042040 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1104350816 12:128042480-128042502 GTCAGATGGGAGGCTGTCTAGGG - Intergenic
1109662197 13:65476156-65476178 ATCAGTTGGAAATATGTCCATGG + Intergenic
1112873677 13:104007469-104007491 CTCCGGTGGAAGTCGTTCCATGG - Intergenic
1114076174 14:19162336-19162358 ATCAGATGGACGTCTGGCCGCGG - Intergenic
1114085985 14:19237232-19237254 ATCAGATGGACGTCTGGCCGCGG + Intergenic
1114762183 14:25328589-25328611 CTCTGATGGTAGTTTGTACAAGG - Intergenic
1116372304 14:44151592-44151614 CTCAGATGGAATTCTGCCTAGGG - Intergenic
1117376550 14:55123175-55123197 CTCAGGGGGAAGTCTTTCCTGGG - Intergenic
1120916531 14:89715414-89715436 CTCAGCTCTATGTCTGTCCATGG - Intergenic
1121184422 14:91954032-91954054 CTCAGTGAGAAGTCTGACCAAGG - Intergenic
1122849710 14:104521187-104521209 CTCACAGGGTAGGCTGTCCACGG + Intronic
1122874255 14:104656267-104656289 CACAGATGCAATCCTGTCCATGG - Intergenic
1122942730 14:104989628-104989650 CTCAGTTGAAAGTGTGTCCCTGG - Intronic
1125728429 15:41879981-41880003 CTCGGATGGCTGTCTTTCCAGGG - Intronic
1126482069 15:49135807-49135829 CTTTGATGGAAGTATGTTCAGGG - Intronic
1127869636 15:63060617-63060639 CTCAATTGGAAGTCTGACCTAGG - Intronic
1128518814 15:68361796-68361818 CTCAGATAGAAGTCTGTCTTGGG - Intronic
1134324995 16:13199426-13199448 ACCAGAGGGAAGGCTGTCCATGG - Intronic
1137448275 16:48546146-48546168 TTCAGAAGGAAGTCTGTCTTAGG - Exonic
1137472768 16:48776790-48776812 TCCAGAAGCAAGTCTGTCCATGG - Intergenic
1138542978 16:57699605-57699627 CTCAGAGGTCAGCCTGTCCAGGG - Intronic
1141409941 16:83826250-83826272 CACAGATGGAAGTCTGGGCGCGG - Intergenic
1144666942 17:17108343-17108365 CTCCGATGGCTGTCTGTCCCAGG - Intronic
1147215303 17:38895859-38895881 CTCAGATGTCAGTCAGTCCTGGG + Intronic
1147661625 17:42120048-42120070 CTCAAATGGAGGGCTGCCCAGGG + Exonic
1149163617 17:53724623-53724645 CACAGATGGAAGTCTCTCTGAGG + Intergenic
1152018716 17:77769225-77769247 CTCAGGTGGGAGTGGGTCCATGG + Intergenic
1153062449 18:1007994-1008016 CTCAGCTGGTAGTCTCTACAGGG - Intergenic
1155332420 18:24731677-24731699 TACAGATAGAAGTCTGCCCAAGG + Intergenic
1157818600 18:50749326-50749348 CTCAGATGGAAATCACTGCAGGG - Intergenic
1157900712 18:51514069-51514091 CTGAGATGCAATTCTGTCTATGG - Intergenic
1160572440 18:79827372-79827394 CTCACCTGGAACTCTGACCAAGG - Intergenic
1161445250 19:4314940-4314962 CTCACTAGGAAGTCTGTCAAAGG - Intronic
926233360 2:11021447-11021469 CTCAGACAGAAGTCTATCCAGGG + Intergenic
928623789 2:33118614-33118636 CTCAGGTGTCAGTCTGTACATGG - Intronic
928813096 2:35253583-35253605 TTCAGATAGGAGTCTGACCAGGG + Intergenic
930090544 2:47528405-47528427 CTCAGCAGGAAGCCTGTCCCAGG - Intronic
930494561 2:52125155-52125177 CTCATATGGAAGTCTTAGCAAGG - Intergenic
931612860 2:64122473-64122495 CTCAGAGGTCAGTGTGTCCAAGG - Intronic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
937342357 2:121099382-121099404 CTCAGAGGGAGGTTTGTGCAAGG + Intergenic
937362075 2:121236517-121236539 CTCAGGTGAAAGCCTGCCCAAGG + Intronic
937771094 2:125721506-125721528 CCCAGCAGGAAGTCAGTCCAGGG - Intergenic
937980964 2:127615143-127615165 CTAAGATGGAGGTCTGTTCAGGG + Intronic
938490768 2:131759857-131759879 ATCAGATGGACGTCTGGCCATGG - Intronic
940356301 2:152746733-152746755 TTGAGCTGGAAGTCTGACCATGG + Intronic
941759376 2:169224539-169224561 CTTAGATGGAAATCTTTCTATGG - Intronic
945406891 2:209459640-209459662 CTCAGATGTAAGAGAGTCCAGGG - Intronic
948597714 2:239091236-239091258 CTCCTATGGGAGTCTGGCCAGGG + Intronic
1171498636 20:25576064-25576086 TTCAGATCAAATTCTGTCCATGG + Intronic
1175443440 20:59005941-59005963 CACAGATGAAAGCCTGTCCTGGG - Intronic
1176077445 20:63254736-63254758 CTCAGCTGCAGGTCTGTCCTGGG - Intronic
1176707932 21:10128826-10128848 ATCAGATGGACGTCTGGCCGTGG - Intergenic
1178035933 21:28582343-28582365 CTCAGATGGTAAGCTTTCCAAGG + Intergenic
1180291982 22:10855961-10855983 ATCAGATGGACGTCTGGCCGCGG - Intergenic
1180494786 22:15885383-15885405 ATCAGATGGACGTCTGGCCGCGG - Intergenic
1182656668 22:31895818-31895840 CCCAGATGAGAGTCTTTCCAAGG - Intronic
1183975701 22:41510863-41510885 CCCAAATGGAAGGCTGTCGAAGG - Intronic
950129429 3:10531904-10531926 CTCAGAAGTGGGTCTGTCCAAGG - Intronic
952331056 3:32364877-32364899 CTCAGCTGGAACTCAGTCCCAGG - Intronic
953657460 3:44864957-44864979 CTTAGAAGGAAGTCAGTCCCAGG + Intronic
957849511 3:85789044-85789066 CTCAGATTGAAGTTTTTCCCAGG + Intronic
968219419 3:196924943-196924965 CTCAAATGGAAAGATGTCCAAGG + Intronic
970881537 4:20937792-20937814 CCCAGCTATAAGTCTGTCCAGGG + Intronic
974168986 4:58241695-58241717 CTCAGATTGAAGTATGTATAGGG - Intergenic
976578229 4:86701638-86701660 CTCAGATGGAAGTATAGCCTTGG + Exonic
985756577 5:1723111-1723133 CTGAGCTGCACGTCTGTCCAGGG - Intergenic
987292762 5:16524027-16524049 CTCAGATGGAAGGCGGGGCAGGG - Intronic
987727023 5:21716379-21716401 CACAGAGGGAGGGCTGTCCAAGG - Intergenic
989334730 5:40302297-40302319 ATCATATGTAAGTGTGTCCATGG - Intergenic
990468177 5:56088790-56088812 CTCAGATGCCAGTCTTTTCATGG + Intergenic
992687105 5:79209724-79209746 CTCAGAGGGCAGTGTGCCCAGGG + Intronic
995061142 5:107812923-107812945 CTCCCATGGAAGTCAGTCCCTGG - Intergenic
996946666 5:129078725-129078747 ATCATATGGAAGTGTGTGCAAGG + Intergenic
997425197 5:133798374-133798396 CTCAGAGGGAGGTCTGTACAGGG + Intergenic
997586773 5:135048149-135048171 CTCTGAAGGAAGTCTTGCCAGGG - Intronic
998538257 5:142954305-142954327 CTCAGATAAAATTCTGACCACGG - Intronic
999764946 5:154732932-154732954 CTCAGATTGAAGTTGGTCCTGGG + Intronic
1004377959 6:15107147-15107169 CTCAGAAAAAAGTCTGTCCTCGG - Intergenic
1006655701 6:35590504-35590526 CTGAGATGGAAATATGTTCAAGG + Intronic
1008059043 6:46977493-46977515 CTCAGAAAGAAGTGTGTCCTGGG + Intergenic
1014471311 6:121818263-121818285 CTCAGATGGAATTTTGGCAAAGG + Intergenic
1017498485 6:155002552-155002574 CTCAGATGGAAGGCTTTTCTGGG - Intronic
1017830145 6:158119467-158119489 CTCAAATGGAAGTCTTTAGAGGG - Intronic
1018459718 6:163986266-163986288 CTGAGTTGGATGCCTGTCCAGGG + Intergenic
1020613396 7:10428583-10428605 CTCAGGTGGAAGCCTGTCTAAGG - Intergenic
1020704170 7:11522212-11522234 CTAAGTAGGAATTCTGTCCAAGG - Intronic
1020823493 7:12999517-12999539 CTCTGATGGTAGTTTGTCCACGG + Intergenic
1024212682 7:47219060-47219082 CTGAGCTGGGAGTCTGTGCAAGG - Intergenic
1025923555 7:65937807-65937829 CACATATGGATGTATGTCCAAGG + Intronic
1026788388 7:73316448-73316470 CTCAGATGGAGGTTTGTGGAGGG - Intronic
1032436898 7:131908214-131908236 CTCAGATGGGAGTCAGTAGAGGG - Intergenic
1039611731 8:38924475-38924497 CTCAGGTGGAGGTCTGAGCAAGG + Intronic
1046937122 8:119895263-119895285 CTCTGATGGAAGTCTATACAAGG - Intronic
1047389754 8:124440483-124440505 TTCAGATGGAGGGATGTCCAGGG - Intergenic
1048271668 8:133033307-133033329 TCCAGATGGAAGTATGTCCTAGG + Intronic
1049296980 8:141846312-141846334 TTCAGATGGAATTCTATTCACGG + Intergenic
1053760855 9:41349290-41349312 ATCAGATGGACGTCTGGCCATGG + Intergenic
1054825845 9:69572657-69572679 CTCAGATGGAGGTGTGTACTGGG - Intronic
1055652078 9:78416111-78416133 CTCAACTGGAAGGCTGTCAATGG + Intergenic
1059470035 9:114498040-114498062 ATCTGATGGAAGTCTGTGTATGG - Intronic
1202792677 9_KI270719v1_random:97706-97728 ATCAGATGGACGTCTGGCCGTGG - Intergenic
1186632668 X:11366928-11366950 CTAAGATGGAAGTATGTTTAAGG + Intronic
1187334668 X:18371819-18371841 CTCAGATGGAAATGAGTACAAGG + Intergenic
1188347417 X:29084061-29084083 CTGAGATGCAAGCCTGTCAAAGG - Intronic
1189522758 X:41787188-41787210 CTCAGATGGAATGCTTTACATGG - Exonic
1190632516 X:52401413-52401435 CTCAGAAGGCAGTCAGTTCAGGG + Intergenic
1191921050 X:66257387-66257409 CTCAGATGCAAATATCTCCAGGG - Intronic
1192004847 X:67199452-67199474 CTCAGATTTATGTCTTTCCAGGG - Intergenic
1195333873 X:103831034-103831056 CACTGTTGGAAGTCTGTACAGGG + Intronic
1199143505 X:144337334-144337356 CTCTGATGGAAGTCTGTTAAAGG - Intergenic
1199571607 X:149272293-149272315 CTCGGATAGAAGTCTGTTCAGGG - Intergenic