ID: 907849978

View in Genome Browser
Species Human (GRCh38)
Location 1:58247151-58247173
Sequence CAGAATGGGGGCAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 607}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907849963_907849978 23 Left 907849963 1:58247105-58247127 CCATACTGGAGGCCAGGAGATGA No data
Right 907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG 0: 1
1: 0
2: 4
3: 40
4: 607
907849967_907849978 11 Left 907849967 1:58247117-58247139 CCAGGAGATGAGCTGGGAGGCTC 0: 1
1: 1
2: 4
3: 47
4: 398
Right 907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG 0: 1
1: 0
2: 4
3: 40
4: 607
907849962_907849978 24 Left 907849962 1:58247104-58247126 CCCATACTGGAGGCCAGGAGATG 0: 1
1: 0
2: 1
3: 13
4: 186
Right 907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG 0: 1
1: 0
2: 4
3: 40
4: 607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907849978 Original CRISPR CAGAATGGGGGCAAGGAGGC TGG Intronic
900403605 1:2482945-2482967 CAGAGTGGGGTCGAGGAAGCAGG - Intronic
900731256 1:4262315-4262337 AAGCATAGGTGCAAGGAGGCAGG - Intergenic
900780084 1:4612270-4612292 CAGAAAAGGGGAGAGGAGGCGGG - Intergenic
900962275 1:5932547-5932569 GCCAATGGGGCCAAGGAGGCTGG + Intronic
901120728 1:6890866-6890888 CAGAATCTGGCCAAGCAGGCTGG - Intronic
901236909 1:7672095-7672117 CAGGAGGGGGGTAAGGATGCAGG + Intronic
901728554 1:11261791-11261813 CCGAAAGGGGGGAAGGTGGCTGG + Intronic
901807604 1:11748222-11748244 CAGTCTGGGGGCAGGGATGCCGG - Intronic
902285628 1:15406739-15406761 CTGAGTGGGGGCAAAGAGGCAGG - Intergenic
902642295 1:17774659-17774681 CAGAAGGGAGCCAGGGAGGCTGG + Intronic
902870569 1:19311629-19311651 GAGAGTGGGGGAAAGGAGTCAGG + Intronic
902885361 1:19400883-19400905 CAGGATCGGGGCAAGGTGGTAGG - Intronic
902920393 1:19663185-19663207 CAGTGTGGTGGCAAGGAGGAAGG + Intergenic
903339021 1:22642778-22642800 CAGGATGCAGGCAAGGAGGGTGG + Intergenic
903357911 1:22759429-22759451 GATAATGGGGGCAGGGTGGCAGG - Intronic
903639384 1:24848259-24848281 CAGGAAGGAGGGAAGGAGGCCGG - Intergenic
904055826 1:27669220-27669242 GAGAATGCGGGTAAGGATGCAGG - Exonic
904391799 1:30190907-30190929 CAGGATGGGCACCAGGAGGCAGG + Intergenic
904408785 1:30312335-30312357 CAGGATGGGGGCAGGGCTGCTGG + Intergenic
904495312 1:30883264-30883286 CAGGCTGGGGGCCAGGAGCCCGG + Intronic
905098653 1:35498568-35498590 CAGAGTGGAGGCAGGGAGGAAGG - Intronic
905176832 1:36141661-36141683 AAGAATGTGCCCAAGGAGGCTGG + Intronic
905268519 1:36771443-36771465 CAGGCTGGGGGCGTGGAGGCTGG - Intergenic
905518120 1:38577408-38577430 CAGGCTGGGGTCAAGGAGGTAGG - Intergenic
905866510 1:41379775-41379797 GAGACTGGTGGGAAGGAGGCAGG + Intronic
906201711 1:43964707-43964729 CAGGCTGGGGGCACTGAGGCAGG - Intronic
906439377 1:45827579-45827601 CAGAATGAAGGAAAGAAGGCAGG + Intronic
906580232 1:46929993-46930015 CAGACTGGGGGACAGCAGGCAGG + Exonic
906603493 1:47148897-47148919 CAGACTGGGGGACAGCAGGCAGG - Exonic
906659316 1:47571380-47571402 CAGCATGGAGGCTGGGAGGCAGG - Intergenic
906754024 1:48291868-48291890 GAAAATGGTGGCTAGGAGGCAGG - Intergenic
907020120 1:51059250-51059272 CAGAGTGGGGGCCAGGAGCAGGG - Intergenic
907351608 1:53836764-53836786 TAGAATGTGGGATAGGAGGCTGG - Intronic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
907780375 1:57561129-57561151 CAGGCTGGGGGAGAGGAGGCAGG - Intronic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908393638 1:63705607-63705629 CTGACTTGGGGCAAAGAGGCTGG - Intergenic
909172575 1:72315171-72315193 CAGACTGGGGGAGAGAAGGCAGG + Intergenic
910439515 1:87238316-87238338 CAGCATGGGGGCAGGGAAGCTGG + Intergenic
910553833 1:88507597-88507619 CAGCATGGGACAAAGGAGGCAGG - Intergenic
910846795 1:91611918-91611940 GTGGATGGGGGCAAGGAGGGAGG + Intergenic
910934436 1:92475957-92475979 CAGAGTGGTGGCAAGCAGGGAGG + Exonic
911364246 1:96917433-96917455 CAGATGGGTGGTAAGGAGGCTGG + Intergenic
911441621 1:97934237-97934259 AAGATTGGGGGAAAGGAGACTGG - Intergenic
912755695 1:112323165-112323187 TAGAAAGGAGGCAAGGAGGAAGG + Intergenic
912802594 1:112729800-112729822 CAGAAGTCAGGCAAGGAGGCTGG - Intergenic
913055415 1:115154154-115154176 GAGCAAGAGGGCAAGGAGGCTGG + Intergenic
913673109 1:121116553-121116575 AAGGATGGAGGGAAGGAGGCGGG - Intergenic
913976046 1:143456517-143456539 CAAACTGGGGGCATGAAGGCAGG + Intergenic
914070443 1:144282137-144282159 CAAACTGGGGGCATGAAGGCAGG + Intergenic
914108712 1:144684217-144684239 CAAACTGGGGGCATGAAGGCAGG - Intergenic
914885483 1:151581062-151581084 TAGAATGGGGCCAGGGAGGAGGG + Intronic
915069625 1:153255352-153255374 CAGACTGGGGCCCAGGAGCCAGG + Intergenic
915081105 1:153353373-153353395 CAGCATGGGGGCAGGGAGTGCGG + Intergenic
915165532 1:153946096-153946118 CAGAAGGGGGTGCAGGAGGCCGG + Intronic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916106295 1:161435035-161435057 CAGGCTGGGGGAAAGAAGGCAGG + Intergenic
916714551 1:167438382-167438404 CAGAATGGAGCCAAGGAGGAAGG + Intronic
916818746 1:168377979-168378001 CAGAATGGGGACAATGTGGCTGG + Intergenic
917485510 1:175451480-175451502 CAGACTGGAGGCCTGGAGGCTGG - Intronic
919763188 1:201111120-201111142 CAGAAGAGAGGCAAGGAGGGAGG + Intronic
919951491 1:202368306-202368328 GAGAATGGGAGCAAGGTTGCGGG - Intronic
920074160 1:203324925-203324947 CAGAATGGGGGCTAGAGGGTGGG - Intergenic
920362223 1:205426871-205426893 CAGGATGGGAGAAAGAAGGCAGG + Intronic
920502703 1:206495458-206495480 TAGAATTGGGGCCAGGAGGTAGG + Intronic
920869804 1:209784577-209784599 CGGAATGGGGGGAAAGAGGGCGG - Intergenic
922531309 1:226347346-226347368 AAGAAAGAGGGCAAGGGGGCTGG + Intergenic
923549734 1:234954036-234954058 CAGAAAGGAGGGAAGGAGGACGG + Intergenic
923924414 1:238608412-238608434 CAGAAGGGGGACAAGAAGGGAGG + Intergenic
924551352 1:245080924-245080946 CACATTGGCGGCTAGGAGGCTGG - Intronic
1062951050 10:1503799-1503821 CAGAGTAGGAGCAAGGGGGCGGG - Intronic
1063081921 10:2775457-2775479 CAGAAGGGTGGAAAAGAGGCAGG - Intergenic
1064149384 10:12849951-12849973 AAGCATGGGGGGAAGGAGGGAGG - Intergenic
1064165821 10:12985276-12985298 CCGAATGCTGGCAACGAGGCAGG + Intronic
1064321486 10:14309655-14309677 CAGGAGGGGGGCCTGGAGGCTGG - Intronic
1064486039 10:15791521-15791543 AAGAATGGGGACTATGAGGCAGG + Intronic
1064565555 10:16635622-16635644 CAGAGTGGGGACAATGAGGTAGG - Intronic
1064592868 10:16912699-16912721 CGGAATGGAGGCCAGGTGGCTGG + Intronic
1064739417 10:18416918-18416940 CAGAATTAGGGCAAGGACCCAGG + Intronic
1065406712 10:25374554-25374576 CATAATGGAGGAAAGGAGGTGGG - Intronic
1065478759 10:26171139-26171161 TACACTGGGGGCAAGGAGGAGGG + Intronic
1065853032 10:29806277-29806299 AAGAATGGGAGCAAGAAGGAAGG + Intergenic
1067034487 10:42902964-42902986 CAAAATGGTGGATAGGAGGCAGG + Intergenic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1067475664 10:46564271-46564293 CATATTGGGTGTAAGGAGGCAGG + Intergenic
1067619072 10:47777504-47777526 CATATTGGGTGTAAGGAGGCAGG - Intergenic
1068634205 10:59330583-59330605 GAGATTGGAGGCAGGGAGGCAGG + Intronic
1069800159 10:71077008-71077030 CAGAAGGCAGGCAGGGAGGCAGG + Intergenic
1069889193 10:71642705-71642727 CAGAGTGGGGGATAAGAGGCCGG - Intronic
1070311259 10:75275724-75275746 CAGACTGAGGGCAAGGGGGCTGG + Intergenic
1071979456 10:90988754-90988776 AAGAATGGGGGGTAGGAGGCTGG - Intergenic
1072058318 10:91783027-91783049 CAGAATGTGGCCATGGAGGATGG - Intergenic
1072614658 10:97041429-97041451 CAGAGTTGGGGCATGGGGGCCGG + Intronic
1073206543 10:101772407-101772429 TAGACTGGAGGCCAGGAGGCAGG + Intronic
1073563246 10:104514931-104514953 CAGACTGGGGGCAGGGTGGGGGG - Intergenic
1075307830 10:121383462-121383484 CAGACTGGGGGCAAGGAAGATGG + Intergenic
1075407942 10:122207000-122207022 CAGTAGGGGAGCAGGGAGGCTGG + Intronic
1075879022 10:125834136-125834158 CACAGTGCAGGCAAGGAGGCTGG - Intronic
1076169772 10:128309482-128309504 AAGAATGGGGGCAGGAGGGCAGG + Intergenic
1076173213 10:128340599-128340621 CAGAAAGGTGGCCAAGAGGCCGG + Intergenic
1076228911 10:128803800-128803822 CAGAATGGGGGCAGGGGTGGGGG - Intergenic
1076358894 10:129872969-129872991 AAGAGTGGGGGCAAGGAGGAGGG - Intronic
1076555279 10:131317521-131317543 GAGAATAGGGGCATGGAGGGTGG - Intergenic
1076700668 10:132271043-132271065 CAGATGGGGTGCAAGGAGGGTGG + Intronic
1076805795 10:132858287-132858309 CAGGTTGGGGGCAGGGAGGTGGG + Intronic
1077034305 11:487489-487511 CAGAACCGGGGCGGGGAGGCCGG - Intronic
1077174113 11:1180982-1181004 CAGACTGGGGGACAGGAGGCCGG - Intronic
1077343489 11:2036267-2036289 CAGATGGGAGGCCAGGAGGCTGG + Intergenic
1077800550 11:5531726-5531748 CAGAATGGGCCCTAGGAGCCAGG - Intronic
1078104397 11:8349683-8349705 CCGACTGGGGGCAAGGGAGCTGG - Intergenic
1078159522 11:8828594-8828616 GAGAATGGGGACAAGCAGGGCGG + Intronic
1078340547 11:10495456-10495478 CAGCCTGGGAGCAAGGTGGCTGG + Intronic
1078450801 11:11439256-11439278 CAGAAGTGGGGCAAAGAGGATGG + Intronic
1080029755 11:27648174-27648196 AAGAATGGGGGAGAGAAGGCTGG + Intergenic
1080355734 11:31443522-31443544 CAGAATGTGGGCAAGTAGTTAGG - Intronic
1080660590 11:34293004-34293026 AAGAGTGGGGTCAAGGAGACAGG + Intronic
1080842875 11:36000809-36000831 GAGCTTGGGGGCCAGGAGGCTGG + Intronic
1081580826 11:44350494-44350516 CAGAAAGAGGGCAAGATGGCTGG - Intergenic
1081981756 11:47270815-47270837 GAGAACTGGAGCAAGGAGGCTGG - Intronic
1082879680 11:58025493-58025515 CAAAAAGGGAGAAAGGAGGCCGG - Intronic
1083030473 11:59587202-59587224 CAAAAGTGGGGAAAGGAGGCTGG + Intronic
1084569282 11:69949743-69949765 CAGAAGGGCTGGAAGGAGGCAGG + Intergenic
1084687567 11:70705854-70705876 AAGCATGGAAGCAAGGAGGCAGG - Intronic
1085451904 11:76639202-76639224 CAGAATGGGGTCAGGGAGACTGG - Intergenic
1085479664 11:76810696-76810718 CAGGAAGGAGGCCAGGAGGCAGG + Intergenic
1085555056 11:77412008-77412030 AAGAAAGGAGGGAAGGAGGCGGG + Intronic
1085800546 11:79585395-79585417 CAGAGTGGGGGCTTGGAGTCAGG + Intergenic
1086605611 11:88692831-88692853 CAGGATGGAGGCATGGAGGGTGG - Intronic
1086605969 11:88696463-88696485 CAGAAGGGAGGCAGGGAGGCAGG - Intronic
1087901890 11:103650658-103650680 CAAAATGGTGGATAGGAGGCAGG + Intergenic
1089535467 11:119158342-119158364 CAGGCTGGGGGAGAGGAGGCTGG + Intronic
1089581119 11:119482569-119482591 CAGGCTTGGGGCCAGGAGGCAGG + Intergenic
1090213461 11:124939536-124939558 TAGAATGGGAGGAAGGAGGAAGG + Intergenic
1090317525 11:125807052-125807074 CTGACTGAGGGCCAGGAGGCAGG + Intergenic
1090484096 11:127096646-127096668 CAGAATGAGGGAAAAGAGGAAGG + Intergenic
1090659449 11:128871274-128871296 AAGATTGGGGGCAAGGAGTGGGG - Intergenic
1090752775 11:129761986-129762008 CTGGATGGAGGTAAGGAGGCAGG + Intergenic
1090809454 11:130223798-130223820 GGGAATGGCAGCAAGGAGGCTGG + Intergenic
1091171609 11:133524811-133524833 CAGAATGAGGGCAAGAAGCTTGG - Intronic
1202826475 11_KI270721v1_random:91456-91478 CAGATGGGAGGCCAGGAGGCTGG + Intergenic
1091423013 12:359811-359833 GAGAAGGGAGGCAAGGAGGGAGG + Intronic
1091454688 12:598345-598367 CAGAGGGAGGGCAAGGAGGAGGG - Intronic
1091920555 12:4301062-4301084 CAGACTGGGGGCAGGAAGGGAGG - Exonic
1093756974 12:22863338-22863360 CAAAGTGGGGCAAAGGAGGCAGG + Intergenic
1094013136 12:25830109-25830131 CAGAATTGGGGAAAAGAGCCTGG - Intergenic
1094108853 12:26839735-26839757 CACTATGGGGGAAAGGTGGCTGG - Intergenic
1094303742 12:28994884-28994906 CAGTAAGAGGGCAAGAAGGCCGG - Intergenic
1094346012 12:29469873-29469895 CAAGATGGGGTCAGGGAGGCAGG + Intronic
1095409558 12:41907340-41907362 GAGTGTGGGGGCAAGCAGGCCGG - Intergenic
1095419585 12:42011425-42011447 AAGGATGGGGTCAGGGAGGCAGG - Intergenic
1095869347 12:47009185-47009207 GAGAAAGAGGGCAATGAGGCTGG + Intergenic
1096003688 12:48150970-48150992 TACAATGGGGGCAAGCAGGGTGG + Intronic
1096072308 12:48782239-48782261 CAGAATGTGGGGCTGGAGGCAGG - Intronic
1096696393 12:53351633-53351655 AAGAAGGTGGGCAGGGAGGCCGG + Intergenic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1097374809 12:58828901-58828923 AAGGATGTGGGCAACGAGGCAGG + Intergenic
1097500202 12:60392283-60392305 AAGGATGGGGCCAAGGTGGCAGG - Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1100241118 12:92711338-92711360 CAGACTGGGGGAGAGAAGGCAGG + Intergenic
1101514292 12:105420050-105420072 CAAAGTGGGGGCAGGCAGGCAGG + Intergenic
1101552434 12:105775262-105775284 CAGAATGTGAGCAAGGAATCAGG - Intergenic
1101580676 12:106038727-106038749 CAGAAGAGGGGCATGGATGCTGG - Intergenic
1102096636 12:110246489-110246511 CAGAATTGGGGCAAGGGAGAAGG - Intergenic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102884520 12:116511479-116511501 AAGCCTGGAGGCAAGGAGGCAGG - Intergenic
1103012953 12:117471406-117471428 AAGAATGGGTGCCAGGAGACTGG - Intronic
1103894926 12:124266638-124266660 AAGAGTGGGGACCAGGAGGCGGG + Intronic
1103988661 12:124784019-124784041 CAGAATGGGGACAGGGAAGGAGG - Intronic
1104013499 12:124948027-124948049 CAGGATGGGGTCACTGAGGCAGG - Intronic
1104714378 12:131006641-131006663 CAGAAGGAGAGCAAGGAGGGTGG + Intronic
1104877285 12:132044331-132044353 CAGCAGGGGGGCAAGAGGGCAGG - Intronic
1105279122 13:18952988-18953010 CAGGATGGGCTCCAGGAGGCAGG + Intergenic
1105728320 13:23187115-23187137 CAGAATGGTGGCAGGGAGGGAGG - Intronic
1106125099 13:26894935-26894957 CAGGATGGGGGAACTGAGGCTGG - Intergenic
1106314616 13:28582426-28582448 CAGAGTGGGGGAAAGGAGCCAGG - Intergenic
1106346698 13:28886313-28886335 CAGCAGGGGAGCAGGGAGGCAGG + Intronic
1106566640 13:30890678-30890700 CAGAAGGGAAGCAAGGAAGCAGG - Intergenic
1107087557 13:36442501-36442523 CAGAATGGAAGGAAGGAAGCTGG - Intronic
1108322475 13:49302065-49302087 CAGAATGAGGGCAGAGTGGCAGG + Intergenic
1108820426 13:54342695-54342717 ATGGATGGGGGCAGGGAGGCGGG - Intergenic
1110014784 13:70386862-70386884 CTGGAGGGGGGCAAGGTGGCAGG + Intergenic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1111317533 13:86582071-86582093 CAGGCTGGGGGAAAGAAGGCAGG - Intergenic
1112315973 13:98362295-98362317 CAGAATGGGGGGTAGCTGGCTGG - Intronic
1112470242 13:99681880-99681902 CAGAAAAGATGCAAGGAGGCAGG - Intronic
1112517056 13:100063010-100063032 CAGAATGGCAGCAACGAAGCTGG + Intergenic
1113185519 13:107682358-107682380 CAGGATGAGTGCAAGGAGGGTGG - Intronic
1113240117 13:108328087-108328109 GAAAATGGTGGCTAGGAGGCAGG + Intergenic
1113314955 13:109169018-109169040 CAGAAGGGTGGCAAGGTGGGAGG - Intronic
1113957343 13:114105892-114105914 CAGCGTGGGGGAAAGGAAGCGGG + Intronic
1115130727 14:30049530-30049552 CAGGCTGGGGGAAAGAAGGCAGG - Intronic
1115463165 14:33684592-33684614 AAGAATGAGAGCAAAGAGGCTGG - Intronic
1115483594 14:33886685-33886707 AAGCATGGGACCAAGGAGGCCGG + Intergenic
1116021763 14:39469691-39469713 GAGGATGGGGGCAGGGAGGAGGG + Intergenic
1117869359 14:60183738-60183760 GAGAATGCAAGCAAGGAGGCTGG + Intergenic
1119262407 14:73245576-73245598 CAGAACGGGGGCAGGGACGTTGG + Intronic
1119318882 14:73717912-73717934 CAGAGCAGAGGCAAGGAGGCTGG + Exonic
1119556856 14:75559978-75560000 CAGAGAGGGGGCGAGGGGGCAGG + Intergenic
1119625738 14:76173595-76173617 CAGAAAGGGGCGAAGAAGGCTGG + Exonic
1120357652 14:83454919-83454941 AAGAATGGGGGCTTGGATGCTGG + Intergenic
1120585962 14:86312636-86312658 CTGCAAGGCGGCAAGGAGGCTGG + Intergenic
1120873144 14:89355911-89355933 AAGAACGGGGATAAGGAGGCAGG + Intronic
1122938043 14:104968884-104968906 CAGAGTGAGGCCATGGAGGCGGG + Intronic
1122940569 14:104979199-104979221 GAGAATGGGGGCAAAAGGGCTGG + Intergenic
1123154368 14:106210147-106210169 CAGAGCGGGTGGAAGGAGGCTGG - Intergenic
1123820981 15:24030460-24030482 GAGAATAGGGGCCTGGAGGCAGG - Intergenic
1124045741 15:26148355-26148377 CAGAATCGGGGCAGGGAGAGTGG - Intergenic
1124102888 15:26712390-26712412 CAGAAGAGCAGCAAGGAGGCTGG + Intronic
1124415882 15:29473014-29473036 TAGGAAGGGGGAAAGGAGGCAGG + Intronic
1126176805 15:45743399-45743421 CAGAAATTGGGAAAGGAGGCAGG - Intergenic
1126630882 15:50733992-50734014 CAGAATGCTGGCAAGGATGTGGG + Intronic
1126790328 15:52215540-52215562 CAGAATGGTGGCAGGGAGAGAGG - Intronic
1127256482 15:57297836-57297858 CTGACTGGGGGCCAGGATGCAGG + Intronic
1127274228 15:57428087-57428109 CAGAAATGTGGCAAGGAGGAAGG + Intronic
1127296642 15:57614582-57614604 CAGAAGGGAGGCAGTGAGGCAGG + Intronic
1127694667 15:61433502-61433524 GACAATGGTGGCTAGGAGGCAGG - Intergenic
1127699158 15:61480288-61480310 CAGAATGGGAGCAGAGAGGTGGG + Intergenic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1128354920 15:66919358-66919380 CTGAGCAGGGGCAAGGAGGCAGG + Intergenic
1128705420 15:69834588-69834610 CACAATGTGGGCAAGTAGGGAGG - Intergenic
1128830580 15:70764202-70764224 CGGAATGGGGGCGGGGAGGGAGG + Intergenic
1129112520 15:73345865-73345887 CAGAGCGGGTGCAAGGCGGCTGG + Intronic
1129714745 15:77840458-77840480 TAGCCTGGGGGCAAGGTGGCTGG - Intergenic
1130190074 15:81725933-81725955 CAAAGTGGGGGCAGGGAGGGAGG - Intergenic
1130735028 15:86538903-86538925 TAGAATGGGACCAAGGAGGAAGG + Intronic
1131310667 15:91287396-91287418 CAGAAAGGTGGGAAGGAAGCAGG - Intronic
1131871794 15:96771309-96771331 CGGACTGTGGGAAAGGAGGCTGG - Intergenic
1132079608 15:98852848-98852870 CAGAATAAGGGCAGGGATGCCGG - Intronic
1132552336 16:558778-558800 GAGAGCGGGGGCCAGGAGGCCGG - Intergenic
1132905672 16:2281426-2281448 CGGACTGGGGGCCAGGATGCGGG + Exonic
1133087253 16:3374606-3374628 CAGAATTGGGGGAAAGAAGCAGG + Intronic
1133932079 16:10240810-10240832 CACACTGGGGGGAAGGGGGCAGG + Intergenic
1134392587 16:13833174-13833196 CAGAAGGGAGGAAAGGAGGCAGG - Intergenic
1135750528 16:25055194-25055216 CAGAAAGGAGGCAGGGAGGCCGG - Intergenic
1135759580 16:25126340-25126362 CAGAGAGGAGGCAGGGAGGCCGG - Intronic
1136153203 16:28365496-28365518 CAGAATGGGGGGATGGAGGGTGG + Intergenic
1136209883 16:28749777-28749799 CAGAATGGGGGGATGGAGGGTGG - Intergenic
1137349769 16:47703344-47703366 TAAAATGGGGGCAAAGGGGCCGG + Intergenic
1137357892 16:47784118-47784140 CAGCCTGGAGGCAAGCAGGCTGG - Intergenic
1137627130 16:49916307-49916329 CAGAGTGGGAACAAGGAGGGTGG - Intergenic
1137650341 16:50114640-50114662 CAGGATGAGGGCAGGAAGGCGGG - Intergenic
1137856175 16:51796662-51796684 AAGAATGGGGGCATGGATCCTGG + Intergenic
1138430124 16:56963148-56963170 CAGGCTGGGGGTAGGGAGGCGGG + Intronic
1139026618 16:62825404-62825426 GAAAATGGGGTCAAGGAGACAGG + Intergenic
1139049625 16:63108055-63108077 CAAGATGGAGGCAAGGATGCAGG - Intergenic
1139303143 16:65962084-65962106 AAGAAGGGAGGGAAGGAGGCAGG + Intergenic
1139351337 16:66338045-66338067 CCAAATGGAAGCAAGGAGGCTGG + Intergenic
1139371740 16:66473349-66473371 CAGAAGTGGGGCAGGGAGGCCGG - Intronic
1139588419 16:67919167-67919189 CAGAGTGGAGGCAGGGAAGCGGG + Intronic
1140474487 16:75232689-75232711 CAGAACGGTGGCAGGGTGGCAGG - Intronic
1140519346 16:75567937-75567959 CAGAGTGTGGGCAAGGAGGTGGG - Intronic
1141427214 16:83952083-83952105 CAGAAGGGAGGCAGGGAGGGAGG - Intronic
1141517325 16:84554250-84554272 CAGACTGGGGCCCAGGAGGTGGG + Intergenic
1141554031 16:84825265-84825287 CAGAGTGGGGGCCAGCAGCCAGG + Intronic
1141559512 16:84857768-84857790 CAGGCTGGGGGAAAGAAGGCAGG + Intronic
1141633528 16:85301853-85301875 CAGAATGGGGACAAGGTCACGGG - Intergenic
1141878370 16:86841873-86841895 GAGAATGGAGGCAGGGAGGGAGG - Intergenic
1142246546 16:88972799-88972821 CAAAAGGGGGGACAGGAGGCGGG + Intronic
1142521426 17:507572-507594 CAGAATTGGGGCATGAAGGTTGG - Intergenic
1142751225 17:1989054-1989076 CCTAATTGCGGCAAGGAGGCTGG + Intronic
1142982149 17:3678556-3678578 CAGCAGTGGGGCAAGGAGGCTGG - Intronic
1143015912 17:3891092-3891114 CAGACTGGGGGCAAGGTTGGGGG + Intronic
1143497559 17:7321165-7321187 CTGAACTGGGGGAAGGAGGCTGG + Exonic
1143544360 17:7587895-7587917 CAGAAGGGAAGCAGGGAGGCTGG - Exonic
1143594648 17:7907061-7907083 CAGAAAGGGAGCCAGGAGTCAGG + Intronic
1143646755 17:8235202-8235224 CAGAACGGCGCCACGGAGGCAGG + Exonic
1143679716 17:8467334-8467356 CAGAGTGGGGGCTATGGGGCAGG - Exonic
1143905805 17:10208174-10208196 TAAAAAGGGGGGAAGGAGGCTGG + Intergenic
1143912760 17:10265557-10265579 CAGAATTGGGGGGAGGAGGGGGG - Intergenic
1144695414 17:17301090-17301112 CCGGAGGGGGCCAAGGAGGCAGG - Intergenic
1145879332 17:28342146-28342168 CAGGATGGGGGAAGGGAGGGAGG + Intronic
1146570457 17:33948223-33948245 CAGAATGAGGTAAAGCAGGCTGG - Intronic
1146654089 17:34625184-34625206 CAGAATGGGGGCAGGGAGGGAGG + Intronic
1146910742 17:36646859-36646881 AAGAATAGGAGAAAGGAGGCAGG + Intergenic
1147436838 17:40421572-40421594 CAGAGTGGGGGCAGGGTGGGTGG - Intergenic
1147671722 17:42180515-42180537 CAGAAGTGGGGCAAAGTGGCCGG - Intronic
1148050562 17:44768081-44768103 CAGCATTGGGGCAAGGGGTCTGG + Intronic
1148482618 17:47970083-47970105 AAGACTGGGGACAAGGAGGCTGG - Intronic
1148634124 17:49133985-49134007 CGGAATGGGGGAAAGGAAGGCGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148745723 17:49916899-49916921 CAGAGTGGAGGTAGGGAGGCTGG - Intergenic
1148794394 17:50190129-50190151 GTGAATGGAGGGAAGGAGGCAGG + Intronic
1149000131 17:51748838-51748860 CAGAAAGGTGGAAAAGAGGCAGG - Intronic
1149353831 17:55818877-55818899 CAGAAGGGTGGCCAGGAGGGAGG + Intronic
1149661064 17:58334082-58334104 CAGAATGGGACCCAGGAGCCCGG + Intergenic
1151037779 17:70821328-70821350 TAGGATGGGGGAGAGGAGGCAGG + Intergenic
1151442038 17:74135762-74135784 AAGAAGGGAGGCAAGGTGGCAGG + Intergenic
1152430281 17:80245090-80245112 CAGAAGGGAGGCAGGAAGGCAGG - Intronic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152664505 17:81559471-81559493 CAGAGTGTGGGCATGGGGGCAGG + Intronic
1152897085 17:82918345-82918367 CAGACTGGTGGCAGGGGGGCAGG - Intronic
1153556690 18:6322416-6322438 GAGAATGGAGGCAGGGAGGGAGG + Intronic
1155106110 18:22667859-22667881 CAGAATGAGCCCAAGTAGGCAGG + Intergenic
1156056689 18:33014003-33014025 CAGACTGTGGGCAAGGATGTTGG - Intronic
1156315082 18:35962231-35962253 CAGATGGGGGGCAAGGGGGTGGG - Intergenic
1156535628 18:37862046-37862068 CAGATGTGGGGCAAGGATGCAGG + Intergenic
1156900718 18:42297670-42297692 CAGATGGGGGGCAGGGGGGCGGG + Intergenic
1157527265 18:48393300-48393322 CAGAAGGGAGCCAAGGGGGCAGG - Intronic
1157529893 18:48410888-48410910 CAGAATGGGCACTAGGCGGCCGG - Intergenic
1159052751 18:63436709-63436731 CAGGATGGGGCCAAGGTGGGTGG + Intergenic
1159823352 18:73174809-73174831 CAGTATGGGGTCCAGGAGGATGG + Intronic
1159925411 18:74264664-74264686 CACAATGGAGGCACGGAGGCAGG + Intronic
1160362252 18:78293829-78293851 CAGAATCCTGGCAAGCAGGCGGG + Intergenic
1160542849 18:79634583-79634605 CACAGTGGGGGCGAGGATGCTGG - Intergenic
1160657677 19:281819-281841 AGGAATGGGGGCATGGAGGGGGG + Intronic
1161112870 19:2479469-2479491 GAGAATGGAGGCGAAGAGGCGGG + Intergenic
1161153684 19:2721651-2721673 CCGAGTGGGGGCCAGGAGCCCGG + Intronic
1161218925 19:3108980-3109002 GAGACTGAGGGCAAGGAGGAAGG + Intronic
1161594466 19:5144164-5144186 GGGGCTGGGGGCAAGGAGGCGGG - Intronic
1162549570 19:11351055-11351077 CAGAACTGGGGAATGGAGGCAGG + Intronic
1162748414 19:12812708-12812730 TAGAAGAGCGGCAAGGAGGCCGG + Intronic
1163056665 19:14725143-14725165 GAGAATGGGAGCGAGCAGGCAGG + Intronic
1163101526 19:15100141-15100163 AAGCATGGGAGGAAGGAGGCAGG + Intergenic
1163115348 19:15185556-15185578 CAGAGTGGGGGCAAGGAGCCAGG + Exonic
1163182748 19:15615699-15615721 CAGGATGCGGGCCAGGAGCCAGG - Exonic
1163186270 19:15641498-15641520 CAGGATGCGGGCCAGGAGCCAGG - Exonic
1163274611 19:16275602-16275624 CAGAATGGGGATACTGAGGCTGG + Intergenic
1164725852 19:30465164-30465186 GAGAATAGAGGCAAGGTGGCAGG - Intronic
1164781602 19:30897395-30897417 CCAAATGGAGGCAAGGGGGCTGG + Intergenic
1164853614 19:31503883-31503905 AGGAAAGGGGGCAAGGAGGAAGG + Intergenic
1165426718 19:35750031-35750053 CAGAAGGGGGACACTGAGGCAGG + Intronic
1165549699 19:36573566-36573588 CAGAATGGGGAACAGGAAGCTGG + Intronic
1165991152 19:39814973-39814995 CAGAATAGAGTCAAGGAGGAAGG + Intergenic
1166009148 19:39928182-39928204 CAGACTGGAGATAAGGAGGCGGG + Exonic
1166194751 19:41198434-41198456 GGGAATGGGGGCAGGGAGGTAGG - Intronic
1167151655 19:47713620-47713642 CAGACTGGGGACAGGGTGGCAGG - Intronic
1167446292 19:49539536-49539558 GAGAATGGGGGTCAGGAAGCTGG + Intronic
1167537756 19:50065826-50065848 AAGTCTGGGGGCCAGGAGGCTGG + Intergenic
1168427861 19:56253312-56253334 CAGAAGGTGGGCAGGGAGGAGGG + Intronic
925253957 2:2466359-2466381 CTGAGTGGGAGCGAGGAGGCTGG - Intergenic
925273985 2:2636177-2636199 AAGGGTGGGGGCAAGGGGGCAGG - Intergenic
925717808 2:6801115-6801137 CAAAATGGGTGTATGGAGGCAGG + Intergenic
927132837 2:20074982-20075004 CAGGATGGAGGCAGGGTGGCTGG - Intergenic
927185287 2:20477891-20477913 TAAAATGGGGGTAAGAAGGCCGG - Intergenic
927317289 2:21698944-21698966 CTCAATGGAGGCAAGGGGGCTGG - Intergenic
927962413 2:27249348-27249370 CAGGATGGGGGAAAGCAGGGAGG + Intergenic
928311438 2:30213670-30213692 CAGCCTGGTGGCAGGGAGGCGGG + Intergenic
928907229 2:36381082-36381104 AAGAAGGCGGGCAGGGAGGCTGG - Intronic
929588066 2:43128330-43128352 CAGAGTAGGGGCATGGAGGAAGG + Intergenic
929972996 2:46599991-46600013 GAGAATGGAGGTAGGGAGGCTGG + Intronic
931098844 2:58973030-58973052 CAGAAAGGGGGCAATGGGGGAGG - Intergenic
931102421 2:59017387-59017409 CAGAAAAGGGGAAAGGAGGGAGG + Intergenic
931511761 2:63004875-63004897 CAGAATGTGGGTAAGGGGGTGGG - Intronic
931813681 2:65879390-65879412 CAGGGTGGGTGCAATGAGGCAGG + Intergenic
932276985 2:70458907-70458929 CAGAATGGGGCCGGGGAGCCTGG + Intronic
932301790 2:70672621-70672643 CTGAGTTGGGGCAAGGAGCCGGG + Intronic
932400635 2:71478880-71478902 CAGAGAGGGATCAAGGAGGCAGG - Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932708725 2:74047051-74047073 CAGGAAGGGGGCAAGAAGCCTGG - Exonic
933823917 2:86141231-86141253 AAGGATGGGGGCAGGGAGGAGGG - Exonic
934167008 2:89302926-89302948 CAGAATGGGGCCAAGAAGCAAGG + Intergenic
934180745 2:89617508-89617530 CAAACTGGGGGCATGAAGGCAGG + Intergenic
934200269 2:89879528-89879550 CAGAATGGGGCCAAGAAGCAAGG - Intergenic
934291044 2:91691744-91691766 CAAACTGGGGGCATGAAGGCAGG + Intergenic
934574472 2:95391464-95391486 CACCATGAGGGCAAGGAGGAAGG + Intergenic
935860555 2:107324491-107324513 CAGCATGGGGGCAGGGTGGAAGG + Intergenic
936641257 2:114314955-114314977 CAGGCTGGGGGAAAGAAGGCAGG - Intergenic
937324873 2:120984621-120984643 GAGAATGGGGACAGTGAGGCCGG + Exonic
938416154 2:131105304-131105326 CAGAACGGCGGCCAGGACGCCGG + Exonic
938630056 2:133156737-133156759 GAGATTGGAGGCAAGGAAGCAGG - Intronic
939017717 2:136920911-136920933 CAGAATGGTTGCCAGGAGGAGGG + Intronic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939177931 2:138771740-138771762 CAGAGTCGGGGCAAGGCAGCTGG + Intronic
939427974 2:142065413-142065435 CAGAATGAGGCCAAGCAGGAAGG - Intronic
940744852 2:157555784-157555806 CATAATGGGGGGAAGCAGGGAGG + Intronic
940978588 2:159975088-159975110 TACAATGGGGGCATGAAGGCGGG - Intronic
941773289 2:169364864-169364886 CAGAAGAGGGGAAAGGAGGGAGG + Intergenic
942636979 2:178018141-178018163 CAGAATGGCGGCTGGGTGGCAGG - Intronic
942809598 2:179982187-179982209 TAGACTGGGGGCAAGTCGGCAGG + Intronic
944444449 2:199775385-199775407 CCAAATTGAGGCAAGGAGGCTGG + Intronic
945554471 2:211262229-211262251 CAGAATGAGGGCAAGGACAGGGG - Intergenic
946146565 2:217735492-217735514 GAGAATGGCGGGCAGGAGGCTGG - Intronic
946197511 2:218043923-218043945 CAGAAGGGGGCTGAGGAGGCAGG + Intronic
946650380 2:221886906-221886928 AAGCATGTGGGCAAGGCGGCTGG - Intergenic
946838876 2:223799969-223799991 CCGAAGTGGGGCAAGGAGGGCGG + Intronic
947487650 2:230567210-230567232 TGGAATGGGGGCAAGGAGGGAGG - Intergenic
948079686 2:235195637-235195659 CAGAATGGTGGGATGGAGCCAGG - Intergenic
948125077 2:235558594-235558616 CAGTGTGGGGGAAAGTAGGCTGG - Intronic
948815845 2:240510073-240510095 AAGCAGGGGGGCAGGGAGGCAGG - Intronic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
1169291643 20:4358327-4358349 CAGAATGCAGTCAAGGATGCAGG + Intergenic
1169410971 20:5370094-5370116 AAGAATGAGGGGCAGGAGGCAGG - Intergenic
1169810119 20:9601327-9601349 CAGAATGGGGGAAAGAGGTCAGG + Intronic
1170255897 20:14342876-14342898 CAGAGGGTGGGCAAGCAGGCAGG - Intronic
1170695042 20:18650407-18650429 CAGGATGTGGGCAGGGAGGACGG - Intronic
1171460529 20:25295580-25295602 TGGAATGGGAGAAAGGAGGCTGG - Intronic
1172270442 20:33652760-33652782 CAGAAAGAGAGCAAAGAGGCCGG + Intergenic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172644867 20:36462721-36462743 CACAAAGGGGGAAAGGAGGGAGG + Intronic
1173729224 20:45317040-45317062 CAGCAAAGGGGCAAGGAAGCAGG - Exonic
1173844221 20:46177898-46177920 CAGGATGGGGCCAATCAGGCAGG + Intronic
1174264699 20:49322973-49322995 GAAGATGGGGGAAAGGAGGCTGG + Intergenic
1174318061 20:49718184-49718206 CAGAGTGAGGGCAGGGAGGAAGG - Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174533777 20:51235636-51235658 TACAAAGGGGACAAGGAGGCTGG + Intergenic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1175207714 20:57324204-57324226 CAGAGTGGGGGCTAGGGGACTGG + Intergenic
1175553917 20:59834286-59834308 CAGCATGGGGGCCAGGAATCTGG + Intronic
1176424302 21:6538510-6538532 CAGAATGGTGGCACCGGGGCTGG + Intergenic
1176515851 21:7782899-7782921 TAGAATGAGGGCAAGGATGAAGG - Intergenic
1176857749 21:13985483-13985505 CAGGATCAGGGCCAGGAGGCTGG - Intergenic
1177681413 21:24376008-24376030 AAAAATGGGGGATAGGAGGCAGG - Intergenic
1178379549 21:32096501-32096523 CAGAAAGGGGGCAGAGAGGAGGG - Intergenic
1178649879 21:34412911-34412933 TAGAATGAGGGCAAGGATGAAGG - Intergenic
1179582388 21:42351985-42352007 GAGAATGGGGGCCTGGAGGATGG - Intergenic
1179699795 21:43146825-43146847 CAGAATGGTGGCACCGGGGCTGG + Intergenic
1179732277 21:43374547-43374569 CAGAGTGCGGGCAGGGTGGCGGG - Intergenic
1180036442 21:45252693-45252715 CACACTGGGGGCTGGGAGGCTGG + Intergenic
1180954636 22:19736217-19736239 CTGGAAGGGGGCATGGAGGCTGG - Intergenic
1181100166 22:20533594-20533616 CAGAGTGGGGCCAAGGAGCAAGG - Intronic
1181318190 22:21984822-21984844 CAGGGTGGTGGCAGGGAGGCAGG - Intergenic
1181618485 22:24071355-24071377 CAGAATGGGGGCCAGAGCGCAGG + Intronic
1181920987 22:26320349-26320371 CAGAATGGGGCCAATAAGGGGGG + Intronic
1182898789 22:33880827-33880849 CAGAATGGGCACAGCGAGGCAGG - Intronic
1183079836 22:35449334-35449356 CACGATAGGGGCAAGGAGCCTGG - Intergenic
1183641001 22:39092332-39092354 CAGGATGGGAGGAAGGAGACTGG - Intergenic
1184032635 22:41903983-41904005 CAGAGTGGGCTCCAGGAGGCAGG - Intronic
1184245347 22:43232967-43232989 CAGCATGGGGGCCTGGAGGTCGG - Intronic
1184245684 22:43234756-43234778 CAGAATGCTGGCCAGCAGGCAGG - Intronic
1184264763 22:43341209-43341231 TGGAAAGGGGACAAGGAGGCAGG + Intronic
1184783097 22:46658803-46658825 TAGGATGGGGGCAGGGGGGCGGG - Intronic
1184835315 22:47017485-47017507 CAGAATGCTGGCGAGGAGGTGGG + Intronic
1185401385 22:50619884-50619906 CACAAAGGAGCCAAGGAGGCTGG + Intergenic
949134039 3:540986-541008 CAGAATGGAGGGAAGGAAGAGGG - Intergenic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
950143849 3:10634032-10634054 CAGAAAGGCGGCAAGGAAGAAGG - Intronic
950154214 3:10709503-10709525 CAGAATGGAGGCAGAGAGGATGG - Intergenic
950210470 3:11119336-11119358 AAGAATGGAGCAAAGGAGGCCGG - Intergenic
950475454 3:13211768-13211790 CAGGATGGGGGCAGGGAGAGAGG - Intergenic
950476892 3:13220355-13220377 AAGAATGGGGGCAAAGAAGGGGG + Intergenic
952295708 3:32060277-32060299 CAAACTGGTGCCAAGGAGGCCGG - Intronic
953904377 3:46861152-46861174 GTGGAGGGGGGCAAGGAGGCAGG - Intronic
954071147 3:48143759-48143781 CAGAATGGTGGGAAGGGTGCTGG - Intergenic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954421382 3:50420823-50420845 CAGGCTGGGGGCAAGGAGGAAGG - Intronic
954625536 3:52020123-52020145 CCGGATGGGGGCAAGGAGCCAGG - Intergenic
954777174 3:53029894-53029916 CATCTTGGGGGCAGGGAGGCTGG + Intronic
956112938 3:65889272-65889294 GAGAATGTGGGCAAGGAGATGGG + Intronic
956491328 3:69775079-69775101 CAGATGAGGGGCAAGGAGGTGGG - Intronic
958586160 3:96091029-96091051 CAGAAGTGGGGCATGGGGGCAGG + Intergenic
959018020 3:101158141-101158163 TGGAATGGGGGAAAGAAGGCAGG - Intergenic
960172557 3:114479095-114479117 CAGGATGGGGGGAAGAAGGAAGG + Intronic
960993917 3:123328853-123328875 CAGAATGGGGGTGAGGCTGCAGG + Intronic
961112262 3:124294868-124294890 CAGAATGGAGGCAAGCATCCTGG - Intronic
961665291 3:128490388-128490410 CGGATTGCGGGCAAGGAGGCTGG - Intronic
961788009 3:129359085-129359107 CAGGATGGGGGCAGGGAGAGAGG + Intergenic
961945518 3:130682838-130682860 CAGAGAGGTGGCAAGAAGGCCGG + Intronic
962057057 3:131883691-131883713 AAGAAGGGCAGCAAGGAGGCAGG - Intronic
962285138 3:134078955-134078977 CAGACTGGGAGAAAGGAGCCAGG + Intronic
962406406 3:135104191-135104213 CTGAATGGGGCCAGGAAGGCTGG + Intronic
964032059 3:152149685-152149707 CAGCATGGGTTCAAGGAGACAGG + Intergenic
964113430 3:153110784-153110806 CTGTATGGGGGCACTGAGGCAGG - Intergenic
964231533 3:154475937-154475959 CAGAATATGGGCACAGAGGCAGG + Intergenic
965080390 3:164024796-164024818 GAGAAAGGGGGAAAGGAGGGAGG + Intergenic
965331824 3:167384461-167384483 GAGAGTGGGGTCAAGAAGGCAGG + Intergenic
965736476 3:171826053-171826075 CAGAGTGAGGGAAAGCAGGCAGG + Intergenic
966395281 3:179495620-179495642 AAGAAAGGAGGCAGGGAGGCAGG + Intergenic
966470488 3:180283402-180283424 CAGGATCAGGGCAAGGAGGAGGG + Intergenic
966514570 3:180804152-180804174 TAGAATAGTGTCAAGGAGGCAGG + Intronic
966596170 3:181726286-181726308 AAGATTGAGGGCGAGGAGGCTGG - Intergenic
968016754 3:195341986-195342008 CAGAAAGGGGGGAAGGTGGGAGG + Intronic
968123659 3:196143297-196143319 GAGAAGGAGGGCAACGAGGCCGG + Intergenic
968434726 4:578577-578599 TAGAAAGGGGCCAGGGAGGCTGG - Intergenic
968619002 4:1595243-1595265 CAGCAGGGGTGCAAGAAGGCGGG + Intergenic
968662853 4:1805935-1805957 CAGAAGGTGGGCAGGGCGGCAGG + Exonic
968800213 4:2738386-2738408 CAGGCTGGGGGAGAGGAGGCAGG - Intergenic
968906981 4:3458235-3458257 CAGGCTGGGGGAGAGGAGGCAGG - Intergenic
969428282 4:7138495-7138517 CTGGATGGGGGCAAGGACTCCGG + Intergenic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
969930813 4:10629087-10629109 AAGAATGGGGGCATGGGAGCTGG - Intronic
970097184 4:12477355-12477377 AAGAATGGGAGCAAGGTGGGTGG + Intergenic
972422591 4:38903458-38903480 AAAAATGAGGTCAAGGAGGCTGG - Intronic
973216058 4:47670667-47670689 CAGCATGGGCACAGGGAGGCAGG + Intronic
974810156 4:66935624-66935646 TAGAGTGGAGGCAAGGAGCCAGG - Intergenic
975370913 4:73586486-73586508 CAGAAAGGGGGGCAGAAGGCAGG - Intronic
975728463 4:77315431-77315453 CAGACAGGGGGCTAGAAGGCAGG - Intronic
976133416 4:81909035-81909057 GCGAATGGGGGCAAGGGAGCGGG + Intronic
979472180 4:121111817-121111839 CAAAATGTGGGCATGGTGGCCGG - Intergenic
979767046 4:124474862-124474884 CAGGCTGGGGGAAAGAAGGCAGG - Intergenic
980562996 4:134501979-134502001 CAGATGGGGGGAAAGGGGGCAGG - Intergenic
982062210 4:151615933-151615955 CAGAATGGGTGACAGGAGGGTGG + Intronic
984202434 4:176742081-176742103 CAAAATGGGGGGAAAGAGGGAGG - Intronic
985034370 4:185823175-185823197 CATAAAGGGGAAAAGGAGGCCGG - Intronic
985485474 5:146145-146167 CAGAATGGGGGAGAGGAGGGAGG - Intronic
985673969 5:1220841-1220863 CAGAATGGGGGGTTGGAGGAGGG - Intronic
986130194 5:4923013-4923035 CAGAATGTGGCCAAGGTGACAGG + Intergenic
986636048 5:9823560-9823582 CAGAAAGGGGGGAAAGAGGAAGG + Intergenic
987874338 5:23660365-23660387 CAGAATGGGAGTGAGGAGGTGGG + Intergenic
989045175 5:37267321-37267343 CAGGCTGGGGGCGAGAAGGCAGG + Intergenic
989097860 5:37797587-37797609 CAGGCTGGGGGCGAGAAGGCAGG - Intergenic
989594384 5:43142647-43142669 CAGAATGGGGGTGGGGAGGTAGG - Intronic
989622004 5:43393649-43393671 AAGAATGGAGGAAAGGAGGCCGG - Intronic
989735397 5:44697288-44697310 CAGAGTGGGGGGAAGTAAGCAGG - Intergenic
989828405 5:45886828-45886850 CTGCAAGGTGGCAAGGAGGCTGG - Intergenic
990476116 5:56163158-56163180 CAGAGTGAGGGCAAGAATGCAGG - Intronic
990502649 5:56412039-56412061 CAGAATGTGAGAAAGGAGGAAGG - Intergenic
990522070 5:56589866-56589888 CAGAATGGAGGGAAGGACCCTGG - Intronic
991368541 5:65894438-65894460 CTGAATGGGGAAAAGGAGACAGG - Intergenic
992388517 5:76309270-76309292 CAGAAAGAAGGCAGGGAGGCTGG + Intronic
992414944 5:76543446-76543468 GAGAGTGAAGGCAAGGAGGCCGG - Intronic
993791816 5:92219176-92219198 CAGACTAGGGGAAAGAAGGCAGG - Intergenic
993965452 5:94355017-94355039 TCGAAGGGGGGCATGGAGGCAGG + Intronic
994232472 5:97323879-97323901 CAGAATGGGGACAGTGAGGTAGG - Intergenic
994664999 5:102695263-102695285 CAGAATGAGGGCAAGGGTGAGGG + Intergenic
994665322 5:102697775-102697797 TAAAATGGGGGCAATAAGGCCGG + Intergenic
995269524 5:110205197-110205219 CAGGCTGGGGGAAAGAAGGCAGG + Intergenic
995356271 5:111241343-111241365 CAGACTGGGGGCATAGGGGCTGG - Intronic
996223495 5:120961233-120961255 CAGAATGCAGGCTGGGAGGCTGG + Intergenic
996759651 5:126974295-126974317 AAGGATGGGGGCCAGGAGCCTGG - Intronic
997234906 5:132267194-132267216 CAGAGTTTGGGCAAGGAGACTGG + Intronic
997300158 5:132797881-132797903 CAGACTGGGAGCAAGGAGATTGG + Intronic
998383318 5:141741460-141741482 CAGAACTGGGGCCAGGGGGCTGG - Intergenic
998488610 5:142526033-142526055 CATGATGGGAGAAAGGAGGCTGG + Intergenic
999519799 5:152339545-152339567 CTTAATGGGGGGATGGAGGCAGG + Intergenic
1001449968 5:171817133-171817155 CTGATTTGAGGCAAGGAGGCTGG - Intergenic
1001957357 5:175857151-175857173 CAGAATGGAGCCCAGGTGGCAGG - Intronic
1002065833 5:176651222-176651244 CAGAAAGGAGGCTAGGAGCCTGG + Intronic
1002526878 5:179820033-179820055 CAGAACTGGGGCAAGGAGAGGGG - Intronic
1002537447 5:179885095-179885117 AAGAATAGAAGCAAGGAGGCCGG - Intronic
1002968021 6:1986855-1986877 CAGAATGAGAGTAAGGGGGCTGG + Intronic
1005173175 6:23011900-23011922 TAGCATGGGGGCAAGGTGGGTGG - Intergenic
1005458774 6:26047475-26047497 AAGAATGGCTTCAAGGAGGCCGG - Intergenic
1005491022 6:26347110-26347132 AAGAATGGGGGCTAGGATCCTGG - Intergenic
1006641466 6:35491755-35491777 AGGGATGGGGGCTAGGAGGCTGG + Intronic
1007228503 6:40331440-40331462 CAGAATGGAGGCTAGTAGCCAGG + Intergenic
1007302323 6:40876610-40876632 AAGAAGGGAGGAAAGGAGGCAGG - Intergenic
1007494842 6:42252613-42252635 CAGAATGGGGCCATGGAGATGGG + Intronic
1007543585 6:42672785-42672807 AAGAAAGTGGGGAAGGAGGCAGG - Intronic
1007983163 6:46179891-46179913 AAGAGTGAGGACAAGGAGGCAGG + Intergenic
1008216787 6:48800812-48800834 CAGAATGGTTGCATGGAGCCAGG + Intergenic
1008526101 6:52408686-52408708 CAGCCTGAGGGCCAGGAGGCTGG + Intergenic
1008921979 6:56851690-56851712 CAGTTTGGGGGCAGGGAGGGCGG - Intronic
1009972599 6:70640913-70640935 CAGTAGAGGGGTAAGGAGGCAGG - Intergenic
1010547295 6:77173781-77173803 CAGAGTGGGGGAAATGAAGCTGG + Intergenic
1010832822 6:80552100-80552122 CAGAATGGGGGTGTGGAGGTTGG - Intergenic
1011517796 6:88170886-88170908 AAGAAGGGGGGTGAGGAGGCAGG + Intergenic
1011968821 6:93195843-93195865 CAGAATGAGTGCTAGGTGGCTGG + Intergenic
1012520170 6:100111800-100111822 CAGGATATGGGCCAGGAGGCTGG + Intergenic
1013289091 6:108705596-108705618 CAGGATGGTGGCAATGGGGCTGG - Intergenic
1014348559 6:120309090-120309112 CATTGTGGGGGAAAGGAGGCTGG - Intergenic
1015237603 6:130988790-130988812 AAGAATGAAGGAAAGGAGGCTGG + Intronic
1016622290 6:146125693-146125715 CAGAATGGAGAAAAGGAGGGGGG - Intronic
1016835004 6:148468091-148468113 AACAAAGGGGGCAGGGAGGCGGG - Intronic
1016856307 6:148673984-148674006 CAGAATTGGGGCAAGGGAGATGG + Intergenic
1016883365 6:148933638-148933660 TAGAATGGAGGAAAGGAGACTGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017112087 6:150941554-150941576 CAGGATGGGGGCAGTGAGGATGG + Intronic
1017215563 6:151901947-151901969 AAAAATGGTGGAAAGGAGGCAGG - Intronic
1017806203 6:157947615-157947637 CAGAACTGGGGCTAGGAGGTAGG + Intergenic
1017977089 6:159367796-159367818 CAGACTGGTGGCGAGAAGGCAGG + Intergenic
1017981282 6:159402667-159402689 CACAATGTGGGAAAGGAAGCAGG + Intergenic
1018341043 6:162851251-162851273 CAGAAGGGAGGCAAGGAGACAGG - Intronic
1019002119 6:168763150-168763172 GAGAATGGAGGCAAGAGGGCAGG + Intergenic
1019325487 7:436352-436374 CAGAATGAGGGCCAAGGGGCGGG + Intergenic
1019348059 7:540080-540102 CAGAGTGGGAGCAGGAAGGCAGG + Intergenic
1019554308 7:1621042-1621064 CACAATGGGGGCAACGTGGACGG - Intergenic
1019655334 7:2191232-2191254 CAGACTGAGGGCAAGTACGCTGG + Intronic
1019979321 7:4609546-4609568 CAGGGTGGGGGCAGGGGGGCTGG + Intergenic
1020474913 7:8582999-8583021 CTGAAGGGGGCCAAGGGGGCAGG + Intronic
1021172231 7:17413036-17413058 CTGAGTGGGGGCAGGGATGCTGG - Intergenic
1022104767 7:27189836-27189858 GAGAATGGCTGGAAGGAGGCAGG - Intergenic
1023638433 7:42236533-42236555 CGGGATGGGCGGAAGGAGGCGGG - Intronic
1023998773 7:45177755-45177777 CGGAATGGGGGGTAGGAAGCTGG - Intronic
1024581097 7:50801850-50801872 CAGTAGGAGGGCAAGGAGGGTGG - Intergenic
1026847308 7:73705369-73705391 CAGAATTGGGGGAGGGGGGCGGG - Intronic
1027685830 7:81278223-81278245 CAGGGTGGGGGAAAGAAGGCAGG - Intergenic
1029304323 7:99607559-99607581 CAGAGAGGGGGCAAGGATGAAGG + Intronic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1031676589 7:124618631-124618653 CAGGCTGGGGGAAAGAAGGCAGG - Intergenic
1034426469 7:151016708-151016730 GGAAATGGAGGCAAGGAGGCTGG + Exonic
1035212173 7:157336820-157336842 GAGACTGGGGGCGAGGGGGCGGG - Intronic
1035819254 8:2574420-2574442 CTGAACGGTGTCAAGGAGGCAGG - Intergenic
1036125455 8:6057741-6057763 CAGAATGGGAGCACGGCGGCTGG - Intergenic
1037805664 8:22056868-22056890 CAGGGTGGGGGCAAGGAGGGTGG + Intronic
1038437691 8:27547722-27547744 TAGAATGGAGGATAGGAGGCTGG - Intergenic
1038773260 8:30503588-30503610 AAGAATGGTGGCGAGGGGGCGGG + Intronic
1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG + Intronic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1042084053 8:65088708-65088730 GAGCCTGGGGGCAAGGAGGAAGG + Intergenic
1042091178 8:65161402-65161424 CAGAATGAGGGCAGGGCAGCAGG + Intergenic
1042212928 8:66399894-66399916 CAGAAGAGGGGCAAGTAGGGAGG + Intergenic
1043561774 8:81501636-81501658 GAGAAGGCTGGCAAGGAGGCGGG + Intergenic
1043590460 8:81826567-81826589 CAGAGTTGGGGCAACCAGGCGGG - Intronic
1044131650 8:88531092-88531114 CAGAAAGGTAGCAAGGAGCCAGG + Intergenic
1044764568 8:95557833-95557855 CTGCAAGGGGGCAACGAGGCTGG - Intergenic
1046085376 8:109427654-109427676 GAGAATGGGGGAAAGGAGTCAGG + Intronic
1046680576 8:117164956-117164978 CAGAATGGGGGAGAGGAGGCAGG - Intronic
1047728867 8:127709199-127709221 AAGAATGAGGCCAAGGAGGCCGG - Intergenic
1048012553 8:130469838-130469860 CAGAATGGAGGTGAGGAGGTGGG + Intergenic
1048292206 8:133189845-133189867 TAGAAGGTGGGCAGGGAGGCTGG + Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048888125 8:138924804-138924826 GAGAATAGGGGCCTGGAGGCAGG + Intergenic
1049019870 8:139948678-139948700 CAGGATTGGGGCTAGGAGCCAGG + Intronic
1049477973 8:142805702-142805724 CTGAAAAGGGGCCAGGAGGCAGG - Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049764894 8:144350591-144350613 CAGAACTGGGGCAGGGAGGAGGG - Intergenic
1051809676 9:21034355-21034377 GAGATTGGAGGCAGGGAGGCTGG - Intergenic
1052838047 9:33265802-33265824 CAGAATCGGGGCAGTGTGGCGGG + Intronic
1052894332 9:33733245-33733267 CTGGATGGAGGTAAGGAGGCAGG + Intergenic
1053105730 9:35406323-35406345 CAGGATAGGGGCAAGGGGGGCGG - Intergenic
1053613896 9:39744072-39744094 CAGATTGGGAGCCACGAGGCTGG - Intergenic
1054553753 9:66632852-66632874 CAGATTGGGAGCCACGAGGCTGG + Intergenic
1055395457 9:75869116-75869138 CCAAATTGAGGCAAGGAGGCTGG + Intergenic
1056215515 9:84402688-84402710 CAGAATAGGGACAAAGTGGCAGG - Intergenic
1056435127 9:86568602-86568624 CTGAATTTGGGCAAGGAGGCTGG + Intergenic
1057868798 9:98702364-98702386 CTGAATGGAGACAGGGAGGCAGG - Intronic
1057885110 9:98823852-98823874 GAGGATGGAGGCAAGGAGGGTGG + Intronic
1057942421 9:99296626-99296648 CAGAAGGGGTGCGGGGAGGCCGG + Intergenic
1058419414 9:104820066-104820088 CAGCCTGGGGACAGGGAGGCAGG + Exonic
1059046201 9:110870313-110870335 CAGAATGGGGGTAAGGGAGTTGG + Intergenic
1059919472 9:119141896-119141918 TAGAATAGAGGCAAGGAGACAGG + Intergenic
1060488619 9:124065519-124065541 CTGAATGGAGGGAGGGAGGCAGG + Intergenic
1060907910 9:127324435-127324457 CAGGATGGAGGCACGGAGGCTGG - Intronic
1061218378 9:129235086-129235108 CAGATTGGGGGAAAGGAGGCCGG - Intergenic
1061242582 9:129383130-129383152 GAGGGTGGGGGCAGGGAGGCGGG + Intergenic
1061278647 9:129584370-129584392 CAGAATGTGAGCATGGAGTCTGG + Intergenic
1061372465 9:130205265-130205287 CAGCAGGGAGCCAAGGAGGCTGG + Intronic
1061416543 9:130450368-130450390 CAGGATGGAGGGAAGGAGGGAGG - Intronic
1061702369 9:132425413-132425435 CAGCATGGGGATAAGGAGGGGGG - Intronic
1061939667 9:133877139-133877161 CAGAAGGGGGTCTAGCAGGCCGG - Intronic
1062059495 9:134487363-134487385 GAGAAGGGGGGCAAGAGGGCTGG - Intergenic
1203770030 EBV:45203-45225 AAACATGGGGGCCAGGAGGCAGG + Intergenic
1186384066 X:9091495-9091517 CAGGCTGGGGGAAAGAAGGCAGG + Intronic
1186510374 X:10125729-10125751 CAGACTTGGGGCAGGGAGGGTGG + Intronic
1187252582 X:17612325-17612347 CAGAACCGGGGGAAAGAGGCAGG - Intronic
1187722446 X:22165435-22165457 CTGAATTGAGGCAAGGGGGCTGG + Intronic
1188394326 X:29661929-29661951 CAGAATGGAGGCAGGAAGGCAGG - Intronic
1188837517 X:34977526-34977548 CAGAATGGTGGCATGGAGAATGG + Intergenic
1190286789 X:48966756-48966778 CAGAATGGGGGCCTTGAGGTGGG - Exonic
1191687249 X:63904402-63904424 CAGAAAGGTGGCAGCGAGGCTGG - Intergenic
1191750376 X:64535877-64535899 CAGACTGGGGGAGAGGAAGCTGG + Intergenic
1192123339 X:68477186-68477208 CAGAGTGGGGGCTATGAAGCAGG - Intergenic
1192432389 X:71121229-71121251 CACAACTGGGGCAAGGTGGCAGG - Intronic
1192510252 X:71717079-71717101 GAGAATGGCGGGAAGGTGGCCGG + Exonic
1192516445 X:71764474-71764496 GAGAATGGCGGGAAGGTGGCCGG - Exonic
1192547180 X:72023798-72023820 GAGACTGGAGGCAGGGAGGCTGG + Intergenic
1194002036 X:88442530-88442552 GAGATTAGGGGCAAGGAGGAGGG + Intergenic
1195732414 X:107980720-107980742 CAGTAGGGGGGCGGGGAGGCGGG - Intergenic
1195941220 X:110169478-110169500 CAGAGTCGAGGCAGGGAGGCTGG - Intronic
1197175960 X:123486081-123486103 AAGGATGGAGGCAGGGAGGCAGG + Intronic
1197240295 X:124116119-124116141 AAGAATGGAGGCTAGCAGGCCGG - Intronic
1197591897 X:128419649-128419671 CAGACTGGGGGAGAGAAGGCAGG - Intergenic
1197817964 X:130517786-130517808 CTGCAAGGCGGCAAGGAGGCTGG + Intergenic
1198031359 X:132756492-132756514 AAGAAAGGGGGAAAGGAGGTGGG - Intronic
1198409942 X:136356560-136356582 GAGAATTGGGGCAAGGATGATGG - Intronic
1198655290 X:138907198-138907220 GGGAATGCGGACAAGGAGGCAGG + Intronic
1199715636 X:150505703-150505725 CAGAATGCCTGCAGGGAGGCAGG - Intronic
1199738581 X:150709704-150709726 CAGAGTGGGAGCAAGGCAGCGGG + Intronic
1200093723 X:153647657-153647679 CAGAAAGGGGGTATGGAGGGAGG + Intronic
1200115909 X:153769644-153769666 GAGAAAGGGGCCAAGCAGGCAGG - Intronic
1200140809 X:153902098-153902120 AAGAGTGGAGGCAGGGAGGCTGG - Intronic
1200213269 X:154356307-154356329 CAGAATGGAGACAGGGAGCCCGG - Intronic