ID: 907856997

View in Genome Browser
Species Human (GRCh38)
Location 1:58313374-58313396
Sequence CAGGTCTGTGTCCCTGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907856997_907857002 15 Left 907856997 1:58313374-58313396 CCCATGACAGGGACACAGACCTG 0: 1
1: 0
2: 1
3: 19
4: 229
Right 907857002 1:58313412-58313434 GACATCCCACAATGGCCTAAAGG No data
907856997_907857005 20 Left 907856997 1:58313374-58313396 CCCATGACAGGGACACAGACCTG 0: 1
1: 0
2: 1
3: 19
4: 229
Right 907857005 1:58313417-58313439 CCCACAATGGCCTAAAGGGATGG 0: 1
1: 0
2: 3
3: 8
4: 108
907856997_907857001 7 Left 907856997 1:58313374-58313396 CCCATGACAGGGACACAGACCTG 0: 1
1: 0
2: 1
3: 19
4: 229
Right 907857001 1:58313404-58313426 CAGATGCAGACATCCCACAATGG 0: 1
1: 0
2: 1
3: 18
4: 173
907856997_907857003 16 Left 907856997 1:58313374-58313396 CCCATGACAGGGACACAGACCTG 0: 1
1: 0
2: 1
3: 19
4: 229
Right 907857003 1:58313413-58313435 ACATCCCACAATGGCCTAAAGGG 0: 1
1: 0
2: 2
3: 15
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907856997 Original CRISPR CAGGTCTGTGTCCCTGTCAT GGG (reversed) Intronic
900015188 1:143859-143881 CAGCTCTGTGGCCCTGTGGTTGG + Intergenic
900045456 1:502468-502490 CAGCTCTGTGGCCCTGTGGTTGG + Intergenic
900067654 1:744198-744220 CAGCTCTGTGGCCCTGTGGTTGG + Intergenic
900186007 1:1333576-1333598 CAGGTCTCGGTTCCTGGCATGGG + Exonic
904443275 1:30546472-30546494 CAGGGCTTTGTCTCTGTCCTCGG - Intergenic
904943056 1:34178051-34178073 CAGCTCTCTGTCCCTGTGGTTGG + Exonic
907189652 1:52637983-52638005 CAGGGATGAGTCCCTGTCATGGG - Intronic
907486336 1:54780850-54780872 CAGGCCTGAGTGCCTGTCTTTGG - Exonic
907856997 1:58313374-58313396 CAGGTCTGTGTCCCTGTCATGGG - Intronic
907920365 1:58905823-58905845 CAGGTCTTAGTGCCTGGCATTGG + Intergenic
908127618 1:61046723-61046745 CTGGTCTGTATCCATGTAATAGG - Intronic
910844591 1:91593068-91593090 CAGTTCTGGGTCCCTGTCCTCGG + Intergenic
911817142 1:102368127-102368149 CAGGTCTTTGGGCCTGTGATGGG - Intergenic
912340152 1:108906733-108906755 CAGGTCTGTGCCCCTGTGCCTGG - Intronic
913183571 1:116345903-116345925 CAGGTCTGTGTTCTGGGCATGGG + Intergenic
913270695 1:117090253-117090275 CATGACTGTGTCCTTGTCTTGGG + Intronic
914678101 1:149919088-149919110 CAGGCCCGTGTCCCTGTCAGAGG - Intergenic
916295995 1:163220941-163220963 CAGGGCTGTGTTCCTTTCAGAGG - Intronic
918135423 1:181669564-181669586 GAGGTCTTTGTCCCTTTCACAGG + Intronic
919254611 1:195105242-195105264 GAGGGCTGTGTCCCTGTAACAGG + Intergenic
920398654 1:205663576-205663598 CTGGTCTGTGTCCCGCTCCTAGG - Exonic
922103017 1:222489592-222489614 CAGCTCTGTGGCCCTGTGGTTGG + Intergenic
922108564 1:222534329-222534351 CAGTTCTGTGTCACTTTCAATGG - Intronic
922263338 1:223962080-223962102 CAGCTCTGTGGCCCTGTGGTTGG + Intergenic
922738650 1:228003857-228003879 CGGGTGTGAGTCCCTGTTATGGG - Intergenic
922802966 1:228372420-228372442 CTGGGCTGTGTCCCAGTCAGAGG + Exonic
924345178 1:243067094-243067116 CAGCTCTGTGGCCCTGTGGTTGG + Intergenic
1062897979 10:1119285-1119307 CAGGTCAGTGTTTCTGTAATGGG + Intronic
1066731158 10:38437715-38437737 CAGCTCTGTGGCCCTGTGGTTGG - Intergenic
1067054355 10:43042398-43042420 CAGGTGTGGCTCCCTGTCCTGGG + Intergenic
1067560491 10:47301271-47301293 CAGGGGAGTATCCCTGTCATAGG + Intronic
1067688380 10:48481585-48481607 CAGAGCTGTGCCCCTGTCCTGGG + Intronic
1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG + Intronic
1070325232 10:75384616-75384638 CAGGGCTGTGTCCCTGCTAGGGG - Intergenic
1073829095 10:107361212-107361234 CAGGCCTGGGTCAGTGTCATAGG + Intergenic
1075852348 10:125599620-125599642 AAGGTGTGTGTTCCTGGCATTGG - Intronic
1076433856 10:130426205-130426227 CAGGCCAGTGTCCCCGTCCTGGG - Intergenic
1076971782 11:138959-138981 CAGCTCTGTGGCCCTGTGGTTGG + Intergenic
1077237402 11:1488359-1488381 CAGCTCATTCTCCCTGTCATGGG - Intronic
1077373245 11:2193460-2193482 CTGGTCTGTGTCACTGTGACAGG + Intergenic
1081673204 11:44953193-44953215 CAGGACAGTGTCCCTGTCCTTGG + Intergenic
1081859570 11:46325025-46325047 GAGGTCTCTGTCACTGTCACTGG - Intergenic
1082814366 11:57498608-57498630 CATGGCTGTGTCCCGGTAATAGG + Intronic
1083642950 11:64155324-64155346 CAGGTCTGCCTCCCTGTCTGAGG + Intronic
1084171865 11:67404807-67404829 ATTGTCTGTGTCCCTGTCCTGGG + Intronic
1084308549 11:68302399-68302421 CTGCTCTGTGTTCCTGTCCTGGG + Intergenic
1084710469 11:70840779-70840801 CAGTTCCTTGTCCCTGTCCTCGG - Intronic
1086381789 11:86262394-86262416 CAGGACTGTGTCCATGCCCTAGG - Intronic
1088135718 11:106553108-106553130 CAGGTCTGAGTTCTTGTCCTGGG - Intergenic
1088609621 11:111564716-111564738 CAGGGATGGGTCCCAGTCATTGG - Intergenic
1093188597 12:16049862-16049884 CATGTCTGTGTCCTTGTTCTTGG + Intergenic
1096885851 12:54718425-54718447 CAGGCCCGTGTCCCTGAGATTGG + Intergenic
1096898798 12:54852967-54852989 CAAGTCAGTGTCCTTGTCCTGGG - Intronic
1097842658 12:64337104-64337126 AAGGTATCTGTCCCTGTAATTGG - Intronic
1098016283 12:66108054-66108076 CAGGTCTGTTTCCCATCCATGGG - Intergenic
1099011792 12:77300075-77300097 CAAGTCTCTGTCCCAGTCCTGGG - Intergenic
1099155225 12:79167187-79167209 CAGGACTTTGTCCTTTTCATAGG - Intronic
1103611877 12:122129115-122129137 CTGCTCTCTGTCCCTGTCCTAGG + Exonic
1103716352 12:122947566-122947588 CAGGGCTGTGACCCTGTGACAGG - Intronic
1103927960 12:124434131-124434153 CAGGGCCTCGTCCCTGTCATGGG - Intronic
1106454205 13:29912260-29912282 CAGCACAGTGTCCTTGTCATGGG - Intergenic
1112599530 13:100841311-100841333 CAGGGATGTGTCTCTGCCATGGG + Intergenic
1113175756 13:107561768-107561790 CCTGTCCATGTCCCTGTCATAGG + Intronic
1113956227 13:114101129-114101151 CAGGCCTGTGTCCCGGCCAACGG + Intronic
1114648074 14:24266743-24266765 CATGTCTCCGTCCCTGTCACGGG - Intronic
1114760436 14:25308300-25308322 CAGGTCTGAGATCCTGTCCTAGG - Intergenic
1116574665 14:46557641-46557663 CTGGTGTGTGTGCCTGCCATTGG - Intergenic
1117029387 14:51652451-51652473 CAGGTCTGTGTCGCTGTGGCTGG + Intronic
1117049256 14:51844184-51844206 CAGCTGTGTGTTCCTGTCACTGG + Intronic
1118175557 14:63436694-63436716 CAGCTATGTGTCACTGTCAACGG - Intronic
1119726559 14:76925003-76925025 CCAGTCTGTGTCACTGTCGTGGG + Intergenic
1119848231 14:77846714-77846736 CAAGTCATTGTCCCTGACATTGG + Intronic
1121507124 14:94485903-94485925 CACGTCTGTGTCCCTGTGCGGGG + Intergenic
1122256244 14:100479216-100479238 CTGCTCTGAGTCCCTGGCATAGG + Intronic
1123089043 14:105734015-105734037 CAGGGATGTCACCCTGTCATAGG + Intergenic
1126274373 15:46859453-46859475 CAGTACTGTGTCCTTGTCATAGG - Intergenic
1126539339 15:49804514-49804536 CAGGTCTCTGGGCCTGTGATGGG + Intergenic
1127308427 15:57730104-57730126 CAGTTCAGTTTCCCTGTCAGGGG + Intronic
1128260534 15:66229781-66229803 CAGCTCTGTGTCCTTGTCCTGGG - Intronic
1128541367 15:68536784-68536806 CACTTCTGTTTCCATGTCATTGG - Intergenic
1128685702 15:69683737-69683759 CCTGTCTCTGTCCCTGTCCTTGG - Intergenic
1128938926 15:71771187-71771209 CAGGACTGTGTCCCTGAAGTTGG + Exonic
1130412387 15:83657856-83657878 CAGCCCTGTGTCCCTGTCCGTGG + Intronic
1130996001 15:88904577-88904599 CAGGTCTGTGTGCCTCTCCCTGG - Intronic
1132130713 15:99275858-99275880 CAGGTCTGTGGCCCAGGGATTGG - Intronic
1132666677 16:1084045-1084067 CAGGGCTCTGTCCCCGTCCTGGG + Intergenic
1133384462 16:5357694-5357716 CCTGGCTGTGTCCCTGTCCTTGG + Intergenic
1135223885 16:20638728-20638750 CAGGTCTGTGCTCCTGGGATAGG + Intronic
1138131542 16:54484306-54484328 CAAGTCTGTGTCCCTGTCAGAGG + Intergenic
1139602965 16:67998000-67998022 CAGGTCTGTGCCACTGATATTGG + Intronic
1140395471 16:74622689-74622711 CAGGTCAGTGTCCTGTTCATGGG - Exonic
1140596786 16:76425257-76425279 TAGGTAAGTGTCCCTGCCATGGG + Intronic
1141045786 16:80715249-80715271 CAGTTCTGTGTCCTTGGCACTGG + Intronic
1141472891 16:84251641-84251663 CAGGTCTGTGTGGCTGGCACAGG + Intergenic
1141584292 16:85023072-85023094 CAGGGCTGTGTTCCTTTCAGAGG - Intergenic
1142157019 16:88537296-88537318 CAGGTCTGGGTCCCGGTCACAGG - Intergenic
1142448465 16:90158563-90158585 CAGCTCTGTGGCCCTGTGGTTGG - Intergenic
1142459020 17:76726-76748 CAGCTCTGTGGCCCTGTGGTTGG + Intergenic
1144800354 17:17921971-17921993 CTGGGATGTGTCTCTGTCATCGG - Intronic
1146055083 17:29576908-29576930 CTGGTCTGTGTCCTCGTCAGAGG + Exonic
1146661798 17:34669796-34669818 CAGGTCTGTGACCTTGGCAATGG - Intergenic
1148389796 17:47263251-47263273 CAGGACTCTGTCCCTGGAATGGG + Intronic
1148857318 17:50585828-50585850 CCTGTCTGTGCCCCTGTCCTGGG + Intronic
1149374234 17:56028135-56028157 CAGGTCAGGGTCTCTGTCATTGG + Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1153141177 18:1973938-1973960 CAAGTCTGTGTTCCTTTCAGAGG - Intergenic
1154316105 18:13304422-13304444 CAGGTCTGTATCTCTGTGTTGGG + Intronic
1155809762 18:30217172-30217194 CAGGTCTCTGTGGCAGTCATGGG + Intergenic
1156863120 18:41861424-41861446 CAAGTCTGTGTCCCTGCCTGAGG + Intergenic
1157675660 18:49566806-49566828 CTGGTCTGAGTCCCTGTTACAGG - Intronic
1159796416 18:72849787-72849809 CAGGGCTGTGTTCCTTTCCTTGG + Intronic
1160554207 18:79715490-79715512 CAGGTGCGTGGCCCTGTCAGGGG - Exonic
1160648739 19:209239-209261 CAGCTCTGTGGCCCTGTGGTTGG + Intergenic
1160990922 19:1860032-1860054 CAGGTCTGAGCCCCTCTCCTGGG + Intronic
1161295647 19:3518977-3518999 TGGGGCTGTGGCCCTGTCATTGG + Intronic
1161638440 19:5404214-5404236 CAGGGCTGTGTCGCTGTCCGTGG + Intergenic
1162723413 19:12675696-12675718 CATGTCTGTGTCTCGGTCCTTGG - Exonic
1163988381 19:20973890-20973912 CAGATCTTTGGCCCTGTGATGGG + Intergenic
1164505664 19:28858889-28858911 CAGTTCTTTTTCCCTGTCTTAGG - Intergenic
1164823882 19:31269941-31269963 CAAGTCTGTCTCCAAGTCATTGG + Intergenic
1165914780 19:39251373-39251395 CAGGTGTGTGCCACTGTCAGAGG - Intergenic
1166596058 19:44051383-44051405 CAGGTCTGTGGCCCTGGAGTTGG + Intronic
1167775724 19:51553388-51553410 CAGGACTGTGTCCCTGGTTTAGG + Intergenic
1168104287 19:54157075-54157097 CAGGTGTGTCTCCCTGACACAGG + Intronic
925035902 2:685713-685735 CAGGTCTCTGGGCCTGTGATGGG - Intergenic
926195876 2:10763295-10763317 CATGTCTGTGTCCCAGTGAAGGG + Intronic
926267522 2:11338206-11338228 CAGGCCTGTGCCACTGTAATTGG - Intronic
927177267 2:20419552-20419574 CAGGTCTGTCTCCCTGTTTGAGG - Intergenic
927501866 2:23588461-23588483 CAAGTCTGTTTCCCTTCCATGGG + Intronic
927602998 2:24460865-24460887 CAGGTGTGAGTCACTGTGATTGG + Intergenic
934984349 2:98873524-98873546 CAGTTCTGTATCCCTGTCCCAGG - Intronic
935291936 2:101618415-101618437 CAGATCTGAGCCCCTGACATAGG + Intergenic
937653934 2:124353027-124353049 CAGTTCTGTGGCCCTGTCAAGGG - Intronic
941708735 2:168688770-168688792 CAGGTCTGTGCCCCTGCCTCCGG + Intronic
943231970 2:185265056-185265078 TAGGTCTCTGTGCCTGTGATGGG + Intergenic
943645792 2:190407564-190407586 TATGTCTGTGTGCCTGTGATGGG - Intergenic
945128425 2:206539387-206539409 CAGGTCTGTGACCCACTCCTAGG + Intronic
946509470 2:220338994-220339016 TAAGTCTGTTTCCCCGTCATTGG - Intergenic
946772264 2:223100772-223100794 CCGATCTGTGTCACTGGCATCGG - Intronic
947590608 2:231383116-231383138 CATTTCTGAGTCCCTGTCCTAGG + Intergenic
948359455 2:237409085-237409107 TAGCTCTGTGGCCCTGTCACTGG + Intronic
948708284 2:239809389-239809411 CGGGTCTGTGTTTCTGTCTTGGG + Intergenic
948884214 2:240874880-240874902 CAGCTGTGTGACCCTGCCATGGG - Intronic
949035772 2:241815164-241815186 CCGGTCTGGGTCCCTTTGATTGG + Intronic
1169732308 20:8799432-8799454 TACTTCTGTGTGCCTGTCATTGG + Intronic
1173229392 20:41182425-41182447 CAGGTATGTAGCCCTGTCACAGG - Exonic
1173252737 20:41373278-41373300 CAGGTCTGTCCCCCTCTCTTGGG - Intergenic
1174486950 20:50867278-50867300 CAGGTCTGAGAAACTGTCATAGG - Intronic
1176028061 20:62996251-62996273 CGGCACTGTGTCCCTGTCCTTGG - Intergenic
1176695950 21:9978302-9978324 TAGGTCTCTGTGCCTGTGATGGG - Intergenic
1176915104 21:14616400-14616422 CAGGTATGTGTCTCTCTCCTTGG - Intronic
1176985992 21:15436852-15436874 CAGTTCCCTGTCCCTTTCATGGG + Intergenic
1177476823 21:21634078-21634100 CAGGTCTCTGGGCCTGTGATGGG + Intergenic
1178440576 21:32594906-32594928 CAGGCCTGAGTCCCTCTCATTGG + Intronic
1182329673 22:29542285-29542307 CAGGTCTCTCTCCCTATCAGGGG - Intronic
1183589470 22:38771384-38771406 CTGGTCTCTGCCCCTGTCCTGGG + Intronic
951054182 3:18128176-18128198 CAGGTGTGTTTCGCTGTCAGAGG - Intronic
951238073 3:20257945-20257967 CTGGTCTTTGTGCCTGCCATTGG - Intergenic
953882167 3:46696242-46696264 CAGGTCTGTGTCCCTGTGGATGG - Intergenic
954197447 3:49005096-49005118 CAGGGCTGTGCCTGTGTCATGGG - Exonic
956878667 3:73488932-73488954 CAGGTGTGTGTGCCTGTAGTGGG + Intronic
957309974 3:78507086-78507108 CAGGACTGTCTCCCTTTGATTGG - Intergenic
958079396 3:88727047-88727069 CAGGTGTATATCCCGGTCATTGG - Intergenic
958680420 3:97323524-97323546 CAGGTCTGTTTCTAAGTCATGGG + Intronic
960744712 3:120874381-120874403 CAAGTCTGTGTATCTGTCTTAGG - Intergenic
966059878 3:175741886-175741908 GATGTCTGAGTCCATGTCATGGG - Intronic
967146996 3:186614837-186614859 CAGCTCTGTTTGCCTCTCATTGG - Intronic
967850594 3:194079859-194079881 CAGTTCCGTGTCACTGTCAGGGG + Intergenic
968369111 3:198210876-198210898 CAGCTCTGTGGCCCTGTGGTTGG - Intergenic
969498183 4:7538103-7538125 CAGGTCTGCCTCTCTGTTATTGG + Intronic
970517288 4:16845461-16845483 CAGGTCTTTGTGCCTGCCGTAGG - Intronic
971117257 4:23663069-23663091 CAGAACTGTGTCCATGTCCTAGG + Intergenic
972044002 4:34640139-34640161 CTGGTCTTTGTGCCTGTCATGGG + Intergenic
973743845 4:53944540-53944562 CAGGGCTGTATGTCTGTCATGGG + Intronic
974171216 4:58269897-58269919 TAGGTCTCTGGCCCTGTGATGGG - Intergenic
976395276 4:84548963-84548985 AGGGTCTGTGTCCCTTTAATTGG - Intergenic
976494838 4:85715839-85715861 CAAGTCTGAGGCCCTGTCTTAGG - Intronic
979257537 4:118620585-118620607 CAGCTCTGTGGCCCTGTGGTTGG - Intergenic
979330813 4:119419962-119419984 CAGCTCTGTGGCCCTGTGGTTGG + Intergenic
980368565 4:131838530-131838552 TAGGTCTCTGTGCCTGTGATGGG - Intergenic
981617801 4:146660264-146660286 CATGTCTGTGTCCCTGTTTATGG - Intergenic
982366404 4:154584343-154584365 CTGGTCTGCATCCCTGTCAAAGG + Exonic
982920446 4:161267357-161267379 TAGGACTGTGGCCCTGTAATGGG + Intergenic
985599719 5:820904-820926 CAGGTCTGTGTCTGTCTCATGGG - Intronic
985733085 5:1561771-1561793 CAGGGCTGGGTCCCTTTCTTGGG + Intergenic
986180962 5:5392605-5392627 CAGGGCTGTGGTCCTGTCAGAGG - Intergenic
986960378 5:13203163-13203185 TAGGTCTCTGTGCCTGTGATGGG + Intergenic
987544414 5:19294184-19294206 CAGGTCTGTGACTCTGCCACTGG + Intergenic
987707165 5:21471922-21471944 CAGGGCTGTGGTCCTGTCAGAGG + Intergenic
993430992 5:87831745-87831767 TAGGTCTGTGGGCCTGTGATGGG + Intergenic
993475335 5:88357594-88357616 CAGGCCTTTGTCCCTGGCTTTGG - Intergenic
995686347 5:114776576-114776598 CAGGTCTCTGGGCCTGTGATGGG + Intergenic
996799386 5:127386178-127386200 CAGTTCTGTGTACCTGTACTAGG - Intronic
997364239 5:133315482-133315504 CAAGGCTGTGGCCCGGTCATTGG - Intronic
998181645 5:139950217-139950239 ATCGTCTGTGTCCCTGGCATTGG - Intronic
998416745 5:141951736-141951758 CAGGTCCCTGTCTCTGTCACTGG - Intronic
998557058 5:143135803-143135825 CAGGACTTTGACCCTGTCCTGGG + Intronic
1000486505 5:161850824-161850846 CAGGTCTGTCTGACTGTCTTTGG + Exonic
1000623036 5:163506348-163506370 CAGGTTTGTGTGACTGTCTTGGG + Intronic
1002061008 5:176626164-176626186 CAGGTCTGGGTCCCCATCACCGG + Intronic
1002597712 5:180335005-180335027 CAGGTCTGTGTCACTTGCATGGG - Intronic
1002728387 5:181316461-181316483 CAGCTCTGTGGCCCTGTGGTTGG - Intergenic
1009021060 6:57948575-57948597 CAGGGCTGTGGTCCTGTCAGAGG - Intergenic
1011700207 6:89948756-89948778 CACATCTGTGTCCCTGACATTGG - Intronic
1013276078 6:108586016-108586038 CAGGTCTGTGTCTATTTCAGAGG - Intronic
1017758688 6:157551394-157551416 CAGGCCTGGGACCCTGGCATGGG + Intronic
1018824691 6:167400229-167400251 CAGGCCTGGGTCCCTCTCATTGG + Intergenic
1022472366 7:30689560-30689582 CTGGGATGTGTCACTGTCATGGG + Intronic
1023399521 7:39781860-39781882 CAGCTCTGTGGCCCTGTGGTTGG - Intergenic
1024072459 7:45797649-45797671 CAGCTCTGTGGCCCTGTGGTTGG - Intergenic
1025279265 7:57615047-57615069 CACGTCTGTGACCCTGGCAGGGG + Intergenic
1025305466 7:57850453-57850475 CACGTCTGTGACCCTGGCAGGGG - Intergenic
1027845526 7:83369265-83369287 CATGTTTTTGTCCCTGTGATAGG + Intronic
1027934933 7:84589794-84589816 CAGGTATTTGTGCCTGCCATGGG + Intergenic
1028001003 7:85498796-85498818 CAGGTCTGTGTACCGGTAGTGGG - Intergenic
1029109216 7:98203802-98203824 CAGTTCTGTGCCCATGTCAGGGG - Intronic
1032049851 7:128641354-128641376 CAGCTCTGTGGCCCTGTGGTTGG - Intergenic
1034568720 7:151937179-151937201 CTGGTCTGTGTGTCTGTCCTTGG - Intergenic
1035482699 7:159200378-159200400 CAGGTGTGTCTCACTGTCGTGGG - Intergenic
1038915446 8:32016338-32016360 CAGGTCTGTGCCACTGTGACTGG + Intronic
1039489504 8:37937026-37937048 CATGGCTGTGTCCTTGTGATGGG - Exonic
1043392180 8:79802444-79802466 CAAGCCTGTGTCTATGTCATTGG + Intergenic
1044014112 8:87029905-87029927 CACGTATATGTGCCTGTCATAGG - Intronic
1046877113 8:119267616-119267638 CCATTCTGTGTCCCAGTCATAGG - Intergenic
1047757346 8:127928721-127928743 CAGCACTGTGTCCCTTTCAAAGG - Intergenic
1049745490 8:144261434-144261456 CAGGACTTTTTCCCTGTCACTGG + Intronic
1049800157 8:144513928-144513950 CTGGTCTGTGTCCCTGTCCATGG + Exonic
1050182416 9:2934939-2934961 CAGGTCTGTGACTCTCTCTTTGG + Intergenic
1052793429 9:32899953-32899975 CAGGTCTGTGGCACTGTCCAGGG - Intergenic
1053632931 9:39964254-39964276 TAGGTCTCTGTGCCTGTGATGGG - Intergenic
1053772822 9:41499279-41499301 TAGGTCTCTGTGCCTGTGATGGG + Intergenic
1054210957 9:62286443-62286465 TAGGTCTCTGTGCCTGTGATGGG + Intergenic
1054314027 9:63562411-63562433 TAGGTCTCTGTGCCTGTGATGGG - Intergenic
1057140977 9:92726666-92726688 CATGACTGTGTCCCTGCCCTGGG - Intronic
1058814066 9:108667764-108667786 CATGTCTCCGTCCCTGCCATTGG + Intergenic
1058922241 9:109628031-109628053 CAGATCTGTGTCAGTGTCATTGG + Intergenic
1062753452 9:138273560-138273582 CAGCTCTGTGGCCCTGTGGTTGG - Intergenic
1203575963 Un_KI270745v1:8339-8361 CAGCTCTGTGGCCCTGTGGTTGG - Intergenic
1185785229 X:2885297-2885319 CAGGTGTGAGTCACTGTAATCGG - Intergenic
1186513796 X:10150852-10150874 CAGGGCTGTGTTCCTTCCATAGG + Intergenic
1187188862 X:17013825-17013847 CAGCTCTGTGTCCCTGTAGCAGG - Intronic
1188484882 X:30671779-30671801 CAGCTCTGTTTGCCTGTCACTGG + Intronic
1192392507 X:70745455-70745477 CAGGTGTGAGCCACTGTCATTGG - Intronic
1193441508 X:81544811-81544833 CAGGCCTGTTTACCTTTCATTGG + Intergenic
1193794131 X:85852449-85852471 CAGGTCTGTGACCCAGTGGTTGG - Intergenic
1195515895 X:105775401-105775423 CAGGTCTCTGTCACTGTCTTTGG + Intergenic
1196828673 X:119759609-119759631 CCAGTCTCTGTCCCTGTCAACGG - Exonic
1198806679 X:140501481-140501503 GAGGTCTGTGGCCCTGGGATTGG + Intergenic
1199731231 X:150634235-150634257 CAGCTGTCTGTCACTGTCATAGG - Intronic
1201574161 Y:15444290-15444312 AAGGCCTGTGTTCCTTTCATTGG + Intergenic