ID: 907859569

View in Genome Browser
Species Human (GRCh38)
Location 1:58338685-58338707
Sequence GTGTGAACAAACACTTGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907859569 Original CRISPR GTGTGAACAAACACTTGCAC AGG Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
905087648 1:35396593-35396615 ATGGGAACAAACACTGGTACGGG - Exonic
906656072 1:47549214-47549236 GTGGGGAAAAACACTTGCCCAGG - Intergenic
906920858 1:50062955-50062977 GTGTGAACAGAACCTGGCACTGG - Intronic
907498533 1:54861422-54861444 CTGAGAGCAAACACTTGCAATGG - Intronic
907859569 1:58338685-58338707 GTGTGAACAAACACTTGCACAGG + Intronic
908923214 1:69221610-69221632 TTGTGAACAAAGACTTACAAGGG - Intergenic
908938231 1:69401065-69401087 GTTTGCTGAAACACTTGCACTGG - Intergenic
915643516 1:157249461-157249483 GTTAGAATAAACACTTTCACTGG - Intergenic
919399353 1:197091240-197091262 GTGTGTGCACACACATGCACAGG + Intronic
922665819 1:227467715-227467737 ATGGAAACAAACACTTGAACAGG - Intergenic
923303453 1:232664979-232665001 GTGTGCACACACACAAGCACAGG - Intergenic
923329927 1:232913632-232913654 TTCTGAACACACACTTGCAATGG + Intergenic
924804782 1:247353517-247353539 GTGTGAGAAAACATTTTCACTGG + Intergenic
1063063951 10:2590147-2590169 GGGTGAACAAGAACTTGCAGGGG - Intergenic
1065177577 10:23094878-23094900 GTCTGTACAAAGATTTGCACAGG + Intergenic
1065223929 10:23523774-23523796 GTGAGGACAACAACTTGCACTGG - Intergenic
1070388559 10:75949124-75949146 GAGTGAACAAACACTTCTTCAGG - Intronic
1071420611 10:85493453-85493475 GTGGAAACAGACTCTTGCACTGG - Intergenic
1072927113 10:99625513-99625535 ATGTGAAAAAACAATTGTACTGG - Intergenic
1074462351 10:113649868-113649890 TAGTGGACAAACAATTGCACAGG - Intronic
1075012514 10:118886872-118886894 GTGTGAATGAAAACCTGCACAGG + Intergenic
1075585324 10:123653210-123653232 GGGTGAAAAAATACTTGCAGTGG + Intergenic
1076709250 10:132322534-132322556 ATGTGTATAAACTCTTGCACTGG + Intronic
1076846853 10:133073384-133073406 CTGTGAACAAATGCCTGCACGGG - Intronic
1076984087 11:223043-223065 GCCTGAACAAACACATGCTCTGG + Intronic
1077477160 11:2795895-2795917 GTGTGGCCAACCCCTTGCACAGG + Intronic
1077832380 11:5887867-5887889 ATTTGAATAAACACTTACACTGG - Intronic
1077961760 11:7083206-7083228 GTGTGAGCACACATTTGCAAAGG + Intergenic
1078515811 11:12021320-12021342 GTGTGAAAACACACTAGTACAGG + Intergenic
1079552738 11:21720398-21720420 GTGTGCACACACACATGCAGAGG + Intergenic
1080761717 11:35256801-35256823 GTGAGAAAAATCACTTCCACTGG + Exonic
1080788464 11:35498043-35498065 ATGTAAACAAGAACTTGCACAGG - Intronic
1082626927 11:55497350-55497372 GAGGGAACAAACACTGGAACTGG - Intergenic
1082691279 11:56307955-56307977 GTCTGTACACACACTTGCACTGG + Intergenic
1086991539 11:93309179-93309201 ACGTGAACAGACACTTTCACGGG + Intergenic
1088185255 11:107159760-107159782 GTGTGAGCACACACTTGTAAAGG - Intergenic
1090711980 11:129395367-129395389 GTGTCAACAAATAATGGCACAGG + Intronic
1091165626 11:133473360-133473382 GACTGAACAAACATTTTCACAGG - Intronic
1097209422 12:57354659-57354681 ATGTGAACAAACACTCGGCCAGG - Intronic
1098116841 12:67187902-67187924 TTGTGAGCAAAAACATGCACAGG + Intergenic
1100250662 12:92819915-92819937 GTTTGAACAAACAGTTGAACGGG - Intronic
1100799885 12:98219983-98220005 ATGTGAACAAAGACTTGAAGGGG + Intergenic
1101756217 12:107622453-107622475 GTTTGGACAAACATTTGAACAGG - Intronic
1104224259 12:126815627-126815649 ATGTGGACACACACATGCACAGG - Intergenic
1108051411 13:46444426-46444448 GTGTGTATACACACATGCACAGG + Intergenic
1109543967 13:63818049-63818071 GTGTGTATACACACATGCACAGG + Intergenic
1109921882 13:69074644-69074666 GTGTGCATATCCACTTGCACAGG - Intergenic
1110375138 13:74784895-74784917 GTGTGAAAAAACACTTTGCCTGG + Intergenic
1111872471 13:93850190-93850212 GGGTGAATAAACATATGCACTGG - Intronic
1112843804 13:103613015-103613037 GTGTGTACAAACACAAACACAGG - Intergenic
1112887381 13:104191420-104191442 GTGTGAAAAAAATCTCGCACCGG + Intergenic
1114944969 14:27669238-27669260 GTCTGAAAAAACACATGCAGTGG + Intergenic
1115408887 14:33050169-33050191 GTGTGAACACCCACTTGACCAGG - Intronic
1119035590 14:71228004-71228026 GTGCGCACACACACATGCACAGG + Intergenic
1122570769 14:102698403-102698425 CTTTGAGCAAACACATGCACAGG - Intronic
1125621353 15:41065557-41065579 GTTCAAACAAAAACTTGCACAGG + Intronic
1126983130 15:54269643-54269665 GTGGGAACAAGCACTAGCCCTGG - Intronic
1130126492 15:81098341-81098363 GTTTGAACAAAGACTTGTTCTGG + Intronic
1137451142 16:48575587-48575609 GTGTGAAGAAACATTTCCCCAGG - Intronic
1139301086 16:65945960-65945982 GTGTGCACATACACTAGCAAAGG - Intergenic
1146532495 17:33621177-33621199 TAGTTAACAAACACATGCACAGG - Intronic
1151345412 17:73498411-73498433 GTGAGAACAAACATTTCCAAAGG + Intronic
1151895498 17:76977758-76977780 GTGTGTCCTAACACCTGCACTGG - Intergenic
1152865323 17:82719094-82719116 GTGTGAAGACACACCTGCTCAGG - Intronic
1153118779 18:1694235-1694257 GTGGGAACCAAGACTTTCACTGG - Intergenic
1155702048 18:28758028-28758050 ATTTCAACATACACTTGCACGGG - Intergenic
1156191177 18:34722314-34722336 GTATAAACAAATACTTGCATAGG + Intronic
1157502143 18:48198777-48198799 GTGTAACCTAACACTTTCACAGG + Intronic
1158059946 18:53328089-53328111 TTCTGAACAACCACTTGCACCGG - Intronic
1158395565 18:57076476-57076498 GTGGGGACAGACACTGGCACAGG - Intergenic
1161940706 19:7401756-7401778 GTCTACACAAACACTTGCAGAGG + Intronic
1163597917 19:18231281-18231303 GTGTGCACACACACGTGCACAGG + Intronic
930052225 2:47225379-47225401 GTATGGCCAAACACTTGCTCAGG + Intergenic
930971843 2:57406005-57406027 GAGTGAGCCAACCCTTGCACTGG - Intergenic
933344105 2:81061425-81061447 GAGTGAACAAGCACTTTCAAGGG - Intergenic
935836994 2:107065547-107065569 GTGTGAAAATACAGTTTCACAGG - Intergenic
937254267 2:120544025-120544047 GTGTGAGCAACCACTTGTGCTGG - Intergenic
940910512 2:159206014-159206036 CTTAGAACAAACACTTGCAGAGG - Intronic
947680477 2:232027019-232027041 GTGTATACAATCACTTGCAATGG - Intronic
948337376 2:237220849-237220871 GCATGAACAAACACTTGAAGAGG + Intergenic
1170456974 20:16542567-16542589 ATATGAACAAACACCTGAACGGG + Intronic
1172687921 20:36771115-36771137 GTTTTAGCAAACACTTCCACAGG + Exonic
1175101466 20:56582225-56582247 GTGTGAAAACAGACTAGCACAGG - Intergenic
1178325879 21:31645142-31645164 GTGTTAACAAATACATGGACTGG + Intergenic
956786070 3:72643404-72643426 CTGTGCACATACTCTTGCACTGG + Intergenic
957351087 3:79022549-79022571 GTGTACACTCACACTTGCACAGG - Intronic
964864299 3:161238422-161238444 GTGTGAACAAAGATTTGCAGTGG + Intronic
965883209 3:173412345-173412367 GTGTGCACACATATTTGCACAGG + Intronic
971159894 4:24123031-24123053 GTGTGTGCAAACACACGCACTGG + Intergenic
976626154 4:87185250-87185272 GTTGGATGAAACACTTGCACAGG - Exonic
977114385 4:93004503-93004525 GTGTGCACACACACTTGTAGGGG - Intronic
983796839 4:171874648-171874670 GTAGGAACAGACACTTGCAGCGG + Intronic
985607908 5:868512-868534 CTGTGAACAATCCCTAGCACTGG - Intronic
985730571 5:1545262-1545284 CTGTGAACACACACCTGCATTGG + Intergenic
991563050 5:67974665-67974687 CTGTTTACAAACACTTTCACAGG - Intergenic
992325496 5:75655728-75655750 GTGTGAACAAACTCATTCTCAGG - Intronic
994790647 5:104222348-104222370 GTGTGTATACACACATGCACTGG + Intergenic
998038102 5:138933527-138933549 GAGTGAATAAACACTTGCTGAGG + Intronic
1000741938 5:164979484-164979506 GTGTGAAAACAGACTTACACAGG - Intergenic
1001240241 5:170063390-170063412 GGGTGCACAAACACTTCCAGGGG + Intronic
1003127130 6:3364204-3364226 GTGCCACCAAACACTTGTACGGG + Intronic
1004242978 6:13944386-13944408 ATTTGAACAAACACTAGCTCAGG - Intronic
1007303573 6:40887138-40887160 CTGTGAACCAACACTTGCTCAGG + Intergenic
1008661481 6:53672492-53672514 GTGTAAAGACACACTTGCAAAGG + Intergenic
1009345259 6:62607173-62607195 GAATGAACACACACTTGCAAAGG + Intergenic
1010118596 6:72345567-72345589 GTGTGAACATACAGTTGGAACGG - Intronic
1010542228 6:77105917-77105939 GTGTCAAATAACAATTGCACTGG + Intergenic
1012197078 6:96356547-96356569 CTGTGAACAAACACTTGATAAGG + Intergenic
1014354902 6:120395718-120395740 TTGTAAACAAACACCTACACAGG - Intergenic
1016550316 6:145272213-145272235 GTTTGGTCAAATACTTGCACAGG - Intergenic
1018466378 6:164049772-164049794 GTGTGAACCAATACAGGCACTGG + Intergenic
1020130060 7:5554823-5554845 GTGTGTACACACAAGTGCACTGG + Intronic
1021044621 7:15907052-15907074 GTGTGTACGCACACGTGCACAGG - Intergenic
1023687868 7:42754941-42754963 CTGTGCACATACACTTGAACAGG - Intergenic
1034523177 7:151636611-151636633 GTCCACACAAACACTTGCACAGG - Intronic
1035321812 7:158034639-158034661 GTGTGAAAAAAAACTAACACAGG + Intronic
1037685897 8:21139174-21139196 GTGTGACCCAAAAATTGCACTGG - Intergenic
1038386982 8:27157616-27157638 GTGTGCACAAAAATTTACACTGG + Intergenic
1038863932 8:31418149-31418171 ATGTGAACAAATACTGGCAAAGG - Intergenic
1043259207 8:78176499-78176521 GGCTAAACAAACACTTGTACAGG + Intergenic
1047036622 8:120946640-120946662 GTGGGGAAAAACACTTGCAATGG + Intergenic
1050021484 9:1288967-1288989 GTGTGTACACATACATGCACAGG - Intergenic
1056244975 9:84685869-84685891 GTGTGTACAGACAGGTGCACAGG - Intronic
1058458458 9:105160093-105160115 GTGTGAGAACATACTTGCACAGG + Intergenic
1059772799 9:117443704-117443726 GAATGAACAAACACTTTCCCAGG + Intergenic
1060082550 9:120664129-120664151 TTGTGCACAAACATTTGCTCTGG + Intronic
1189536696 X:41942628-41942650 TTTTGAACAAACACTTGTAAAGG - Intergenic
1200291559 X:154880152-154880174 GTTCAAACAAACACTTGTACAGG + Intronic