ID: 907860254

View in Genome Browser
Species Human (GRCh38)
Location 1:58345884-58345906
Sequence CCCAGGACGGGGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907860254_907860266 27 Left 907860254 1:58345884-58345906 CCTGCCTCCCTCCCCGTCCTGGG No data
Right 907860266 1:58345934-58345956 CAAGAGCAGCTTCCAGGGACAGG No data
907860254_907860264 22 Left 907860254 1:58345884-58345906 CCTGCCTCCCTCCCCGTCCTGGG No data
Right 907860264 1:58345929-58345951 GCTGCCAAGAGCAGCTTCCAGGG 0: 1
1: 1
2: 2
3: 42
4: 271
907860254_907860263 21 Left 907860254 1:58345884-58345906 CCTGCCTCCCTCCCCGTCCTGGG No data
Right 907860263 1:58345928-58345950 TGCTGCCAAGAGCAGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907860254 Original CRISPR CCCAGGACGGGGAGGGAGGC AGG (reversed) Intronic
No off target data available for this crispr