ID: 907860921

View in Genome Browser
Species Human (GRCh38)
Location 1:58352229-58352251
Sequence CAGGTTAATTTAGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907860921_907860928 4 Left 907860921 1:58352229-58352251 CCTGCCTCCTCTAAATTAACCTG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 907860928 1:58352256-58352278 GAGGACATAATGTAGGGAAATGG 0: 1
1: 0
2: 0
3: 23
4: 291
907860921_907860926 -3 Left 907860921 1:58352229-58352251 CCTGCCTCCTCTAAATTAACCTG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 907860926 1:58352249-58352271 CTGTGCTGAGGACATAATGTAGG 0: 1
1: 0
2: 0
3: 18
4: 211
907860921_907860927 -2 Left 907860921 1:58352229-58352251 CCTGCCTCCTCTAAATTAACCTG 0: 1
1: 0
2: 0
3: 13
4: 137
Right 907860927 1:58352250-58352272 TGTGCTGAGGACATAATGTAGGG 0: 1
1: 0
2: 2
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907860921 Original CRISPR CAGGTTAATTTAGAGGAGGC AGG (reversed) Intronic
900415288 1:2531894-2531916 CAGGTGACTTTGGAGGTGGCAGG + Intergenic
904603511 1:31686260-31686282 CAGGGTAACTTCGGGGAGGCAGG - Exonic
906305963 1:44719338-44719360 AAGGGCAATTTCGAGGAGGCAGG + Intronic
907860921 1:58352229-58352251 CAGGTTAATTTAGAGGAGGCAGG - Intronic
911086330 1:93980445-93980467 GAGCTTAGTTTAGAGGAGGAAGG - Intergenic
911554168 1:99322814-99322836 TAGTCTAAATTAGAGGAGGCTGG + Intergenic
915876080 1:159613316-159613338 GAGGTGAAATTAGAGGATGCTGG + Intergenic
916271579 1:162948401-162948423 CAAGTTTATTTAGAGCAGGAAGG + Intergenic
916281189 1:163053183-163053205 CATATGAATTTAGAAGAGGCAGG + Intergenic
917276345 1:173335818-173335840 TAGGTTACTTTAGGGAAGGCTGG - Intergenic
919604903 1:199669649-199669671 CATGTGAATTTGGAGGAGTCAGG + Intergenic
923656774 1:235923824-235923846 CAGGTTAAGTCAAATGAGGCTGG + Intergenic
1063680389 10:8181757-8181779 AAGGTGAATGTAGAGGAGGCGGG + Intergenic
1065278682 10:24112938-24112960 CATGTGAAAATAGAGGAGGCAGG + Intronic
1067065212 10:43100660-43100682 CCGGTTAAGGTAGAGGAGGCCGG - Exonic
1072748695 10:97960362-97960384 CAGTTTGACTTGGAGGAGGCTGG - Intronic
1073062882 10:100742721-100742743 AAGGTTCATTTAGAGGCGGACGG + Intronic
1074469934 10:113717723-113717745 CAGGTTACTTTTGTGGAGGGTGG - Intronic
1075567245 10:123513759-123513781 CAGGTTCATTTAAAGGAGTAGGG - Intergenic
1076038304 10:127220294-127220316 CAGGAGAATGAAGAGGAGGCAGG + Intronic
1078591256 11:12641978-12642000 GAGAATAATTAAGAGGAGGCTGG + Intergenic
1080405851 11:31978155-31978177 AAGATGAATTTTGAGGAGGCAGG - Intronic
1081925495 11:46824286-46824308 CAGTGTAATTTAAAGGAGTCAGG + Intronic
1082849362 11:57752227-57752249 AAGGTAAATTAAGAGAAGGCGGG + Intronic
1082878920 11:58018863-58018885 TTGGTTAATTTTGAGGAGGAGGG + Intergenic
1084941412 11:72615276-72615298 GAGGTCATTTTGGAGGAGGCAGG - Intronic
1086796146 11:91105216-91105238 CAATTTAAATTAGAGAAGGCAGG + Intergenic
1090433267 11:126664450-126664472 CTGTTTCATTTAGAGTAGGCAGG - Intronic
1091007546 11:131967148-131967170 CAGGTGAATATAAAAGAGGCTGG + Intronic
1092874001 12:12832527-12832549 AAGGATAATTTAGAGGAGGTAGG + Intergenic
1093852019 12:24051974-24051996 GAGGTTAAATAAGATGAGGCCGG - Intergenic
1096989045 12:55783562-55783584 CATGATGATTTAGGGGAGGCTGG + Intronic
1098466831 12:70796854-70796876 CCGGCTAATTTAGTGGAGACAGG - Intronic
1099968193 12:89473497-89473519 CTGGCTATTTTAGTGGAGGCAGG - Intronic
1100308610 12:93374235-93374257 CAGGGTAGCTTGGAGGAGGCAGG - Intergenic
1101800670 12:108019302-108019324 CAGGGTATTTTGGAGCAGGCAGG - Intergenic
1104146152 12:126035747-126035769 AAGATTAATATAAAGGAGGCAGG - Intergenic
1106738865 13:32617549-32617571 CCGTTTGATTCAGAGGAGGCTGG + Intronic
1108106516 13:47016530-47016552 AAGGTAAAATTAGATGAGGCAGG + Intergenic
1111199617 13:84916315-84916337 CAGGCTTATTTTGAGGAGACAGG - Intergenic
1112682592 13:101784126-101784148 CAGGATAAGTTAGAGGAATCAGG - Intronic
1115234579 14:31196446-31196468 CAGGTCAATATAGAAAAGGCAGG + Intronic
1115791129 14:36879780-36879802 CAGGTTATTTCAGAGGAAGGTGG - Intronic
1117321084 14:54623848-54623870 CTGGTTAAGTTAGAGGAGAAGGG - Intronic
1119126497 14:72132129-72132151 CTGATTAATTTAGAGGTGGGAGG + Intronic
1121839444 14:97120539-97120561 CAGGTCAATTTTGAGGGGCCAGG + Intergenic
1122509698 14:102256423-102256445 CAGGCTAATTTAGTGGTGGCGGG + Intronic
1124510965 15:30324774-30324796 GGGATTAATTTAGAAGAGGCAGG - Intergenic
1124512200 15:30336845-30336867 CAGGGAAAGTAAGAGGAGGCAGG + Intergenic
1124730714 15:32193906-32193928 CAGGGAAAGTAAGAGGAGGCAGG - Intergenic
1124731923 15:32205757-32205779 GGGATTAATTTAGAAGAGGCAGG + Intergenic
1125183680 15:36906817-36906839 CAGGATAATTTGGAAGAGGAAGG - Intronic
1126257138 15:46641133-46641155 CTGGTGAATTTAGAGAAGTCAGG - Intergenic
1127855039 15:62947218-62947240 CAGGTTTATTTATCAGAGGCAGG + Intergenic
1127950190 15:63797669-63797691 GAGTTTAATTGACAGGAGGCTGG - Intronic
1130355803 15:83129391-83129413 CAGGTCAACTGAGGGGAGGCTGG + Exonic
1139344270 16:66292486-66292508 CAGGATGATTGAGAGGAGGAGGG - Intergenic
1139426934 16:66886947-66886969 CAGGTTAATTTAGCGGATTGTGG + Exonic
1140016382 16:71190708-71190730 AAGATTAATTTAGAGGACTCCGG - Intronic
1143499013 17:7328136-7328158 CAAGGAAAGTTAGAGGAGGCAGG - Intronic
1144361310 17:14496893-14496915 CTGATTAGTATAGAGGAGGCAGG + Intergenic
1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG + Intergenic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1148086648 17:44997688-44997710 CAGCTTAGTTTAGGGCAGGCAGG - Intergenic
1151593989 17:75065626-75065648 AAAGTCACTTTAGAGGAGGCTGG - Exonic
1153285784 18:3452688-3452710 CAGGTAGTTTTAGAGGAGGACGG - Intronic
1153831673 18:8929426-8929448 TAGTTTAATTTACATGAGGCTGG + Intergenic
1155395915 18:25386724-25386746 CCTGTCAACTTAGAGGAGGCGGG - Intergenic
1156965043 18:43080993-43081015 CAGGTTCATTTAGACTAGGCTGG - Intronic
1158854669 18:61531093-61531115 TGGGTTAATTTTCAGGAGGCAGG - Intronic
1162903243 19:13807900-13807922 CAGGTTAATTTAAAGGAAACAGG + Intronic
926245551 2:11120330-11120352 CAGGTTAGATTAGAGGTGGACGG - Intergenic
927985043 2:27404184-27404206 TAGTATAATTTTGAGGAGGCTGG - Intronic
932235644 2:70119144-70119166 CAGGTTTATTTAGGGTAGGCAGG + Intergenic
933299212 2:80523724-80523746 AAGGTTAATACAGAAGAGGCAGG + Intronic
935665186 2:105505907-105505929 AAGGTTAATTAAGAGGAAGATGG - Intergenic
937704119 2:124898388-124898410 CAGGATAATTTTGTGCAGGCAGG - Intronic
938725699 2:134107155-134107177 GAGATTAAAATAGAGGAGGCTGG - Intergenic
941405635 2:165084135-165084157 AACATTAAGTTAGAGGAGGCTGG - Intergenic
941893106 2:170602662-170602684 CAGAATAATTTAGAGGAGAGAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946567158 2:220979420-220979442 TAGGTTAATCTAGGGAAGGCAGG + Intergenic
1175130738 20:56787644-56787666 CAGATGAATTCAGAGGAGGCTGG - Intergenic
950996302 3:17500926-17500948 CAGCTTAATTTAGAGGAACTAGG + Intronic
954084304 3:48231911-48231933 CAGGGCAATGCAGAGGAGGCAGG - Intergenic
954741059 3:52751008-52751030 CAGGTTAAGTAAAAGAAGGCAGG + Intronic
955179159 3:56650443-56650465 GAGGTTATTTTAGTGGAAGCAGG + Intronic
956025100 3:64974996-64975018 CAGCTGAATTTAGAGTAGACAGG + Intergenic
962310149 3:134320523-134320545 CAGGTTTGATTAGAGGAGGCAGG - Intergenic
967227081 3:187302341-187302363 CAGAATGATTTAAAGGAGGCTGG - Intergenic
968887049 4:3340687-3340709 CAGGCTGATTTACAGAAGGCAGG + Intronic
970172498 4:13303738-13303760 CAGGTTAAGTTAGGAGTGGCTGG - Intergenic
970475702 4:16420735-16420757 CCAGTTAATTCAGAGGGGGCAGG - Intergenic
979566201 4:122156911-122156933 CAGATAAATTTGTAGGAGGCAGG + Intronic
979888533 4:126061906-126061928 CAGGTTAGAATAGAGAAGGCAGG + Intergenic
981624823 4:146743431-146743453 CAGGTTGAATTAGAGGTGGATGG + Intronic
984413638 4:179429258-179429280 GAGTTTAATTGACAGGAGGCCGG + Intergenic
987886494 5:23820196-23820218 CAGATAAATTTAGGAGAGGCAGG + Intergenic
988286119 5:29218605-29218627 GAGGTTGATTTGGGGGAGGCAGG + Intergenic
989499171 5:42146161-42146183 CAAGTTTATTTCCAGGAGGCAGG + Intergenic
991163476 5:63533044-63533066 CAGGGAAAACTAGAGGAGGCTGG - Intergenic
993921968 5:93816059-93816081 CAAGTTAACTCAGAGGAGCCAGG - Intronic
994986564 5:106941016-106941038 AAGGTTTTTTTAAAGGAGGCTGG - Intergenic
995310403 5:110703980-110704002 CAGGTTAATCTGGATGAGACTGG + Intronic
996643553 5:125787836-125787858 CAGTTTAATTGATACGAGGCTGG - Intergenic
998320065 5:141221326-141221348 CATCTTCATTTAGAGGAGACAGG - Intergenic
998897825 5:146818753-146818775 CAGGTTAATAGAAAGGATGCTGG + Intronic
999039615 5:148392901-148392923 AAGATTCATTTGGAGGAGGCAGG + Intronic
999643743 5:153697986-153698008 CAGGCCAGTTCAGAGGAGGCTGG + Intronic
1001968214 5:175929932-175929954 CAGGTACATTTAGGGGAAGCAGG + Intronic
1002249228 5:177913859-177913881 CAGGTACATTTAGGGGAAGCAGG - Intergenic
1002249232 5:177913878-177913900 CAGGTACATTTAGGGGAAGCAGG - Intergenic
1002906046 6:1450017-1450039 CAGGGTAATTAAGAGGTGGGTGG - Intergenic
1002957314 6:1878880-1878902 CAGGTATATTTAGAAAAGGCTGG - Intronic
1004409680 6:15369449-15369471 CAGCTTAATATAGAGGACACAGG - Intronic
1005122046 6:22400823-22400845 CAGCATCATTTAGTGGAGGCTGG + Intergenic
1005756325 6:28927751-28927773 CAGGGAGGTTTAGAGGAGGCAGG - Intergenic
1010573816 6:77508894-77508916 CAGGTTAATTTGGAGGCTTCTGG + Intergenic
1010624338 6:78118444-78118466 CTGATTCATTAAGAGGAGGCTGG - Intergenic
1013899001 6:115129779-115129801 CAGGTTTATTTTGAGGAGAAGGG - Intergenic
1014074599 6:117221894-117221916 CCTGATAATTTAGAGGAGACTGG + Intergenic
1017431727 6:154378126-154378148 CCGGTCCATTTAGCGGAGGCAGG - Intronic
1020402191 7:7791689-7791711 CAAGTTAATTAAGAGCAGACCGG + Intronic
1020887139 7:13832238-13832260 CATGTAACTTTAAAGGAGGCAGG - Intergenic
1024444937 7:49466121-49466143 CTGGGTAATTAAGAGGTGGCAGG + Intergenic
1026222979 7:68416316-68416338 CAGGTTCATTTATATGTGGCTGG + Intergenic
1028315884 7:89402405-89402427 CAGTTTAATTTCAAGGAGGCTGG - Intergenic
1028774139 7:94658429-94658451 CAGGCTACCTAAGAGGAGGCGGG - Intronic
1031568330 7:123327104-123327126 CTGGTTAATTTAGTAGAGACAGG - Intergenic
1032980743 7:137279512-137279534 CAGATTAAGTTAGAAGAGGAAGG + Intronic
1034111457 7:148541556-148541578 CACGTTAATTCACATGAGGCAGG + Intergenic
1035831566 8:2700192-2700214 CAGGCTAATTAAGAGGGGACTGG - Intergenic
1036953921 8:13166851-13166873 GAGGTGAGTTTAGAGGACGCTGG + Intronic
1037838779 8:22229853-22229875 CAGGTTAATACAGAGGTGCCAGG - Intronic
1038357081 8:26839498-26839520 CAGGTACAGTCAGAGGAGGCTGG - Intronic
1038655326 8:29445488-29445510 CAGGTAAATGTAGAGGAGAAAGG - Intergenic
1040565822 8:48565812-48565834 CATGTTAATTTAGAGAGGGAAGG + Intergenic
1044805141 8:95999722-95999744 AAGCTTAATCTAAAGGAGGCAGG + Intergenic
1046882709 8:119327748-119327770 CAGGTTATCCTACAGGAGGCAGG + Intergenic
1048779360 8:137984714-137984736 CAGGTAAATTAAGAGGAAACTGG + Intergenic
1050944871 9:11504065-11504087 CAGTTTAATTGACATGAGGCCGG + Intergenic
1051968299 9:22856435-22856457 CAGGTAAATTTAGAGGCTGCAGG + Intergenic
1059584744 9:115593923-115593945 CTGGTAAATTTATAGAAGGCTGG - Intergenic
1062300252 9:135862860-135862882 CAGGTCAGTTTAGAGTAGACTGG - Intronic
1186656524 X:11617685-11617707 CAGATTTATTTAGAGGAGAAGGG + Intronic
1187318970 X:18223445-18223467 CAGGTTAATGTAGCTTAGGCAGG - Intergenic
1188603011 X:31992630-31992652 TAGGTTATTTTAGTGGAGGAAGG - Intronic
1191009513 X:55746047-55746069 TAGGTCCATTTGGAGGAGGCTGG + Intronic
1191682051 X:63850985-63851007 CAAGTTTACATAGAGGAGGCTGG - Intergenic
1194988009 X:100512169-100512191 CAGAGTAATTTAGGGTAGGCAGG - Intergenic
1196421656 X:115528446-115528468 CTGGTTAATTTTTAGGAGGCAGG - Intergenic