ID: 907861591

View in Genome Browser
Species Human (GRCh38)
Location 1:58358882-58358904
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2088
Summary {0: 1, 1: 1, 2: 22, 3: 194, 4: 1870}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907861591 Original CRISPR AGAGAGAGGCAGAAGGTGGA CGG (reversed) Intronic
Too many off-targets to display for this crispr