ID: 907862179

View in Genome Browser
Species Human (GRCh38)
Location 1:58364131-58364153
Sequence CAGTGTATTAAAGGTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907862179_907862186 18 Left 907862179 1:58364131-58364153 CCAGACACACCTTTAATACACTG 0: 1
1: 0
2: 1
3: 11
4: 90
Right 907862186 1:58364172-58364194 GGGATGTGAACCCTTGAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 183
907862179_907862181 -9 Left 907862179 1:58364131-58364153 CCAGACACACCTTTAATACACTG 0: 1
1: 0
2: 1
3: 11
4: 90
Right 907862181 1:58364145-58364167 AATACACTGCTGTGTCATGCTGG 0: 1
1: 0
2: 1
3: 9
4: 169
907862179_907862184 14 Left 907862179 1:58364131-58364153 CCAGACACACCTTTAATACACTG 0: 1
1: 0
2: 1
3: 11
4: 90
Right 907862184 1:58364168-58364190 AACTGGGATGTGAACCCTTGAGG No data
907862179_907862183 -2 Left 907862179 1:58364131-58364153 CCAGACACACCTTTAATACACTG 0: 1
1: 0
2: 1
3: 11
4: 90
Right 907862183 1:58364152-58364174 TGCTGTGTCATGCTGGAACTGGG 0: 1
1: 0
2: 1
3: 13
4: 215
907862179_907862182 -3 Left 907862179 1:58364131-58364153 CCAGACACACCTTTAATACACTG 0: 1
1: 0
2: 1
3: 11
4: 90
Right 907862182 1:58364151-58364173 CTGCTGTGTCATGCTGGAACTGG 0: 1
1: 0
2: 3
3: 27
4: 180
907862179_907862185 17 Left 907862179 1:58364131-58364153 CCAGACACACCTTTAATACACTG 0: 1
1: 0
2: 1
3: 11
4: 90
Right 907862185 1:58364171-58364193 TGGGATGTGAACCCTTGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907862179 Original CRISPR CAGTGTATTAAAGGTGTGTC TGG (reversed) Intronic
907862179 1:58364131-58364153 CAGTGTATTAAAGGTGTGTCTGG - Intronic
909458322 1:75875777-75875799 CACTATATTAATGGTATGTCAGG + Intronic
919117001 1:193292925-193292947 CAGAGTATTTAAGGTGGGACAGG + Intergenic
923580989 1:235212312-235212334 CAGTGTGTTAAAGTGGTATCTGG + Intronic
924732241 1:246723048-246723070 AAGTGTATTGAATATGTGTCAGG - Intergenic
1068422597 10:56815603-56815625 GAGTCTATAAAAGTTGTGTCAGG - Intergenic
1071245590 10:83759099-83759121 CAGTTTAGTAAAGGTTTCTCAGG + Intergenic
1071431342 10:85609378-85609400 AAGTGAATTAAAGATGTGCCTGG - Intronic
1080662610 11:34309815-34309837 CAGTATTGTCAAGGTGTGTCAGG + Intronic
1081124422 11:39305361-39305383 AGGTGTATTAAAAGTGTATCGGG + Intergenic
1082782254 11:57296890-57296912 CAGACTATTAAAGGTGATTCTGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1090528647 11:127565102-127565124 CAGAGGATCAAAGGTGTGGCTGG + Intergenic
1100671415 12:96816986-96817008 CAGTGTATTGCATGTGTGTCGGG - Intronic
1109599752 13:64609381-64609403 AAGTGTATTAAAGCCATGTCTGG + Intergenic
1112500180 13:99936976-99936998 CAGTGTATTGAAGAACTGTCAGG - Intergenic
1116347855 14:43819047-43819069 CAGATAATTAAAGGTGTCTCAGG - Intergenic
1119609416 14:76048945-76048967 CAGTGTATTTATGGGGTTTCGGG + Intronic
1122082252 14:99274061-99274083 AAGTTTATTAAAGGTGCGTGTGG - Intergenic
1125301977 15:38264653-38264675 CAGTGTATTTAATGTGAGTGTGG + Intronic
1131303888 15:91224243-91224265 CAGTGGATTTCAGGTGTGACAGG + Intronic
1134345407 16:13386560-13386582 CAGTTTCTTAGAAGTGTGTCTGG + Intergenic
1137335120 16:47540728-47540750 CAGTATATTAAAAATGTGTTGGG + Intronic
1138132150 16:54489524-54489546 CAGTGTTTTATAGCAGTGTCAGG - Intergenic
1139834548 16:69827757-69827779 CAGGGGATTAATGGTGTGGCAGG + Intronic
1144322661 17:14145154-14145176 CCCTGTATTATAGGTGTGTGTGG + Intronic
1147496774 17:40924004-40924026 CAGTGTATTAAAGATGGAACAGG - Intronic
1148018275 17:44537742-44537764 CAGGTTGTTAAAAGTGTGTCTGG + Intergenic
1148484002 17:47978860-47978882 CAGTGTATTCAAGCAGTGTCAGG - Exonic
1148866834 17:50633196-50633218 CAGTGTATAAAAGGTATGGAGGG + Intergenic
1150843126 17:68628089-68628111 CAGGGCAGTAAAGGTGAGTCTGG - Intergenic
1151085168 17:71372112-71372134 CTGTTTATTAATGATGTGTCAGG - Intergenic
1153557265 18:6328496-6328518 CAGTGTATTAAAGATATTCCTGG - Intronic
1155370276 18:25092118-25092140 TAGTGTATTAAAGATATGACAGG - Intronic
1159347809 18:67229251-67229273 CAGTGCAAGAAAGGTGTGTCTGG + Intergenic
1160679299 19:405447-405469 TAGTGCAATAAAGGTGTTTCGGG - Exonic
1168466647 19:56607657-56607679 CAGTGTCTTAAGGGCATGTCTGG - Intronic
929446699 2:42007803-42007825 CAGTGTCTTAAATGTGGGTAGGG + Intergenic
929880647 2:45834284-45834306 GTGTTTATTTAAGGTGTGTCTGG + Intronic
930765948 2:55085264-55085286 CAGTGTGTAATAGGTGTGTGTGG + Intronic
934070049 2:88375450-88375472 CACTGTATAAAAGGTGGGTATGG - Intergenic
937371873 2:121303951-121303973 CACTGTATTTTAGGTGTGTTTGG + Intergenic
940015455 2:149099739-149099761 CAGGGTTTTAAAGGTCTCTCTGG - Intronic
941618066 2:167744886-167744908 CTGTGTATAAATGGTATGTCTGG - Intergenic
942840779 2:180358860-180358882 CACTGAGTTAAAAGTGTGTCTGG - Intergenic
942977406 2:182034933-182034955 TAGTGCATTAAAGGTGTGTAAGG - Intronic
943242447 2:185402874-185402896 CAGTGTATTCAACATGTGTGGGG - Intergenic
943451159 2:188044060-188044082 CAGAGCATTAAAGGTGATTCTGG + Intergenic
944215082 2:197246670-197246692 AAGTGTAGAAAATGTGTGTCAGG - Intronic
946548635 2:220775778-220775800 GAGTGAATTAAAGGTGTGGAGGG + Intergenic
946576770 2:221084137-221084159 CAGTGTAGTTAAGTTCTGTCAGG + Intergenic
1173417288 20:42868166-42868188 CAGAGTATTAAGGGTGTTTCTGG + Intronic
1175081616 20:56425256-56425278 AAGTGTTTTAAAGATTTGTCTGG - Intronic
1177947441 21:27489393-27489415 CAGTGTTTTCTAGGTATGTCGGG - Intergenic
1182463114 22:30496071-30496093 CAATGTATTATTGGGGTGTCAGG - Intronic
952591630 3:34962327-34962349 CAGTCTATTCATGCTGTGTCAGG + Intergenic
953327173 3:42022319-42022341 CAGTGGATAAAAGGTGTGACAGG + Intronic
961233659 3:125343885-125343907 CAGTTTATTGTTGGTGTGTCCGG - Intronic
962811386 3:138961806-138961828 CAGTGTAGGAGAGGTGTGTCAGG + Intergenic
967578798 3:191127196-191127218 CTGTGTATTAAAGGAGTTACTGG - Intergenic
974603559 4:64120885-64120907 TAGTCTAATAAAGGTGGGTCTGG + Intergenic
977272410 4:94933620-94933642 CACTTTAGTAAAGGTGTATCAGG + Intronic
978687905 4:111469994-111470016 CAATGTATTATATTTGTGTCAGG + Intergenic
979065341 4:116124726-116124748 TAGTGTAAAAAAGGAGTGTCAGG + Intergenic
980183053 4:129425797-129425819 CAGTGTATGAAAGGTATGTGTGG - Intergenic
982429734 4:155309144-155309166 AAGTGTTTAAAAGCTGTGTCAGG - Intergenic
982894078 4:160894753-160894775 CACTGTCTTAAAGGTATTTCGGG - Intergenic
987267761 5:16276023-16276045 CAGTGTGTGAAATGTGTGTAAGG - Intergenic
992469148 5:77038725-77038747 CAGTACATTAAAGATGTTTCCGG + Intronic
992953319 5:81882328-81882350 CAGTGCATTAAATATGTGTGTGG - Intergenic
993228252 5:85198382-85198404 CAGTGTATTGAAGAGCTGTCTGG - Intergenic
993885317 5:93409147-93409169 CAGGGTACTCACGGTGTGTCAGG - Intergenic
994108199 5:95969792-95969814 CAGTGGATTAAATGTCTGGCAGG + Intergenic
996234636 5:121110370-121110392 CAGTGTATTACTGGTATTTCTGG + Intergenic
999372730 5:151065767-151065789 CAGTGTATTAAATATTAGTCAGG - Intronic
1003465578 6:6376879-6376901 CAGTGTCTTCAAGATGTGTCTGG - Intergenic
1008416611 6:51248048-51248070 GAGTGAATTGAAGGTGTGGCTGG - Intergenic
1008797982 6:55328993-55329015 CAGTGTTTTAAAGATGTATGGGG - Intronic
1015645092 6:135378546-135378568 CAGTGTAATAAATATGTGGCAGG - Intronic
1016770233 6:147841301-147841323 CAGTTTATTGAAGGTGAGTCAGG - Intergenic
1016869427 6:148802014-148802036 CAGTATATTAAGGGTCTGTGAGG - Intronic
1016895358 6:149046094-149046116 AAGTGCATTAAAGCTGTGTATGG - Intronic
1018582030 6:165315948-165315970 ATGTGTCTAAAAGGTGTGTCTGG + Intergenic
1018678148 6:166241052-166241074 CTGTGTATTGAAGGGGTGGCTGG - Intergenic
1021242009 7:18214270-18214292 TCTTGTATTAATGGTGTGTCTGG + Intronic
1021436770 7:20626831-20626853 CAGTGTTTTAAAAGTGTTTTTGG + Intronic
1024603752 7:51008778-51008800 CTGTGTATCAAAGGTGTGTCTGG - Intergenic
1027379389 7:77590354-77590376 CAAAGTATTAAAGTTTTGTCAGG + Intronic
1027593389 7:80141769-80141791 CAAAGTATTAAAGATGTGGCCGG - Intronic
1036912934 8:12773637-12773659 CAGTGTATTAAGGAAGAGTCAGG - Intergenic
1046369644 8:113285203-113285225 CATTGAATTAAAGGTGAGTAAGG + Intronic
1049272800 8:141704894-141704916 CAGTGTAGCACAGGTGTTTCAGG + Intergenic
1051714377 9:19966079-19966101 CAGAGTATAAAAGGGATGTCCGG - Intergenic
1055050262 9:71972846-71972868 CACTGTATTAAAAGTCTGCCGGG + Exonic
1060426250 9:123509100-123509122 CACTGTCTTAAAGGTGAGTAGGG + Intronic
1203787569 EBV:136497-136519 CAGTGTCATAAAGGTGTTGCGGG - Intergenic
1185835515 X:3343096-3343118 CAGTATATTAAAAGTCTGTCTGG + Intronic
1186851861 X:13588422-13588444 CAGTGTATTTAATATGTGTAAGG + Intronic
1187575887 X:20554812-20554834 CAATGTGTAACAGGTGTGTCTGG - Intergenic
1191043938 X:56115653-56115675 CAGTTTACTAAAGGTATATCTGG - Intergenic
1195349273 X:103981485-103981507 ATGTGTATTAAAGGTGCTTCTGG - Intergenic
1195358170 X:104057354-104057376 ATGTGTATTAAAGGTGCTTCTGG + Intergenic
1195832351 X:109072737-109072759 CATTATTTTAAAGGTGTATCTGG - Intergenic