ID: 907862416

View in Genome Browser
Species Human (GRCh38)
Location 1:58366261-58366283
Sequence GAGTGTTTGATCCACCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 1, 2: 5, 3: 17, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907862409_907862416 23 Left 907862409 1:58366215-58366237 CCTTTCCCTCTTGCAAGCTCTCA 0: 1
1: 0
2: 1
3: 23
4: 362
Right 907862416 1:58366261-58366283 GAGTGTTTGATCCACCAGCATGG 0: 1
1: 1
2: 5
3: 17
4: 124
907862415_907862416 -1 Left 907862415 1:58366239-58366261 CCAGCTCAACTACGGGATGGCTG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 907862416 1:58366261-58366283 GAGTGTTTGATCCACCAGCATGG 0: 1
1: 1
2: 5
3: 17
4: 124
907862410_907862416 18 Left 907862410 1:58366220-58366242 CCCTCTTGCAAGCTCTCAGCCAG No data
Right 907862416 1:58366261-58366283 GAGTGTTTGATCCACCAGCATGG 0: 1
1: 1
2: 5
3: 17
4: 124
907862411_907862416 17 Left 907862411 1:58366221-58366243 CCTCTTGCAAGCTCTCAGCCAGC 0: 1
1: 1
2: 1
3: 16
4: 170
Right 907862416 1:58366261-58366283 GAGTGTTTGATCCACCAGCATGG 0: 1
1: 1
2: 5
3: 17
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907862416 Original CRISPR GAGTGTTTGATCCACCAGCA TGG Intronic
900428918 1:2592867-2592889 GAGTGCATGATCTACCAGTACGG - Exonic
901777953 1:11573587-11573609 GAGTGTTTGACCAAACAGCTGGG + Intergenic
907862416 1:58366261-58366283 GAGTGTTTGATCCACCAGCATGG + Intronic
907955943 1:59228402-59228424 GAGTGTTTGATCCATCAACAAGG - Intergenic
909137767 1:71822763-71822785 GCGTGTTTGGGCCACTAGCATGG + Intronic
910984421 1:92991819-92991841 GAATGCTTGATCCACAGGCATGG - Intergenic
913690360 1:121273970-121273992 GACTGTTTCAGCCAGCAGCAAGG + Intronic
914147182 1:145005989-145006011 GACTGTTTCAGCCAGCAGCAAGG - Intronic
916285492 1:163100692-163100714 GAATGCTTTATCCACCACCATGG + Intergenic
916354517 1:163889859-163889881 GAGTGTTTTATCCACCATCATGG - Intergenic
916570845 1:166026254-166026276 GAGTGTTTGATCCCACAGATAGG - Intergenic
920477679 1:206292458-206292480 GACTGTTTCAGCCAGCAGCAAGG + Intronic
921827053 1:219684263-219684285 TAGTGTTTGATAGATCAGCAAGG - Intergenic
922449081 1:225722243-225722265 GAGTGTTGAATCCACCAGCACGG + Intergenic
923505163 1:234599627-234599649 GCGTGTTTACTTCACCAGCACGG + Intergenic
1064613562 10:17128823-17128845 TAGTGTTTGATAGACCAGTAGGG + Intronic
1065172970 10:23050245-23050267 TAGTGTTTGATACATCAGTAGGG + Intergenic
1066089750 10:32005763-32005785 TTTTGTATGATCCACCAGCATGG + Intergenic
1066166863 10:32798055-32798077 GAATGCTTTATCCACCATCATGG - Intronic
1066416077 10:35223278-35223300 GAATGTTTGATCCTCTGGCATGG + Intergenic
1066967863 10:42286174-42286196 GAATGTTTAATCCTCCAGTATGG - Intergenic
1069584829 10:69592256-69592278 GAGTGTCACCTCCACCAGCAGGG + Intergenic
1069839203 10:71328540-71328562 GAGAGTTTTATTCACCAGCGGGG - Intronic
1069854683 10:71433517-71433539 AAGTGTGGGAGCCACCAGCAGGG - Intronic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1076469453 10:130708432-130708454 CAGTCTTCGATCCACCAGGAAGG - Intergenic
1082089248 11:48075917-48075939 GGGTGTTTGAGCCTCCTGCATGG + Intronic
1082218241 11:49600887-49600909 GAATGTTTCATACACCATCAGGG - Intergenic
1084475057 11:69384226-69384248 GAGTGTGTGATCCACCAGCCTGG + Intergenic
1092922391 12:13244375-13244397 GAATGTTTTGTCCACCATCATGG - Intergenic
1093946392 12:25114341-25114363 GAGTTTTTGATCCACCCTAAAGG - Intronic
1104475614 12:129068320-129068342 GAGTGATGTATCCACCAGCCAGG + Intergenic
1105353031 13:19633343-19633365 CAGTGCCTGATCCCCCAGCAGGG - Intergenic
1105384160 13:19914669-19914691 TAGTGTCTTATCCACCACCATGG + Intergenic
1107947010 13:45428079-45428101 TTGTGTCTGATCCATCAGCAGGG + Intergenic
1109485087 13:63008174-63008196 TAGTGTTTGGTAGACCAGCAGGG + Intergenic
1109580922 13:64333368-64333390 TAGTGTTTGATCCAACAACTAGG - Intergenic
1112159204 13:96850724-96850746 GAGTGGCTGCTCCACCAGCCTGG + Intergenic
1117265245 14:54079686-54079708 GAGTGTCTGATCCACAAACAGGG - Intergenic
1117925864 14:60778575-60778597 GAGTGTTTGATCCACTAATACGG + Intronic
1119263298 14:73250769-73250791 GAGTGATTCAGCCACCAGCCAGG - Intronic
1119400603 14:74359799-74359821 GGGTGCTTGATCCACCTGCTGGG + Exonic
1121833721 14:97073675-97073697 TGGTGTCTGAACCACCAGCATGG + Intergenic
1122305392 14:100762937-100762959 CAGTGCTTGATCCACCAATATGG - Intergenic
1122878648 14:104680111-104680133 GGGGGTTTGTTCCACAAGCACGG - Intergenic
1124470399 15:29979271-29979293 TAATGTTTGATCCACCAGGTAGG + Intergenic
1124703465 15:31937791-31937813 GAATGTCTTATCCACCATCATGG + Intergenic
1126975745 15:54178129-54178151 AAGTGTTTGATCATCAAGCATGG + Intronic
1129058398 15:72838904-72838926 GAATTTTTGTTCCAGCAGCAAGG - Intergenic
1129195767 15:73965327-73965349 GAGTGCTTGTGCCACCAGCAAGG + Intergenic
1130548165 15:84871495-84871517 GAGAGTTTAGTCCCCCAGCAAGG - Exonic
1138398148 16:56723323-56723345 GAGTCTTTGATCCAAAAACATGG + Intronic
1138571394 16:57875856-57875878 GAGAGAGTGATTCACCAGCAAGG - Intergenic
1147725236 17:42562711-42562733 GAGTGTGTGATTCACCAGCCGGG - Exonic
1147982373 17:44282490-44282512 GAGTTTTTGCTCCATCAGCCAGG - Intergenic
1148400221 17:47352698-47352720 AAGTTTTTGATCCATGAGCATGG + Intronic
1148774755 17:50089050-50089072 CAGAGTTTGAGCCACCAGGAAGG - Intronic
1151082309 17:71343023-71343045 GAGTATCTGATCTACCAGCATGG + Intergenic
1157549598 18:48572306-48572328 GAGTGTTTGAGCAAGCAGCTGGG + Intronic
1159177916 18:64862858-64862880 GAGTGTTTGATGCACCAGCATGG - Intergenic
1160549369 18:79683567-79683589 GAGTTTCTGATCCATCAGCTGGG - Intronic
1161204733 19:3035118-3035140 TAGTGTGTGATCCGCCAGGAAGG + Intronic
1168276651 19:55282564-55282586 ATCTGTTTCATCCACCAGCATGG + Intronic
925772585 2:7297870-7297892 GAATGCTTTATCCACCATCATGG - Intergenic
926210315 2:10864408-10864430 GAGTGTTTGAAACAGCAGGAGGG + Intergenic
927027942 2:19089643-19089665 CAGTCTGAGATCCACCAGCAAGG + Intergenic
927288856 2:21384894-21384916 GAGTGTGGGTTCCAGCAGCAGGG - Intergenic
929269669 2:39959652-39959674 GAATGCTTTATCCACCATCATGG - Intergenic
930295043 2:49544233-49544255 GAATGTCTTATCCACCATCATGG - Intergenic
930536462 2:52651122-52651144 GAATGTTTCATCCACCATCATGG - Intergenic
931377097 2:61717550-61717572 GAGTGCTTGATCCACAGGCATGG - Intergenic
935815315 2:106841920-106841942 TAGTGTTTGACCAACCAGCTGGG - Intronic
937493587 2:122395006-122395028 GACTTTGTGATCCACCAGCCTGG - Intergenic
942122610 2:172793120-172793142 GAGTGATGCATCCACCAGCAAGG - Intronic
943548046 2:189305906-189305928 ACATGTTTGATCCACCAGCATGG + Intergenic
946143133 2:217708714-217708736 GAGTTCTTGGTCCAACAGCATGG - Intronic
948883123 2:240870421-240870443 GAGCGTTGGCTCCAACAGCAGGG + Intronic
1170110125 20:12795912-12795934 GAGCCTATGATCCAGCAGCATGG + Intergenic
1170281734 20:14656577-14656599 TAGTGTTTTCTCCACAAGCATGG - Intronic
1170937543 20:20823181-20823203 TAATATTTGATCCACCAACATGG - Intergenic
1173085328 20:39910617-39910639 GAGCGTTTCATCCAGCATCACGG + Intergenic
1177660659 21:24078733-24078755 TAGTGTTTGATACCACAGCAAGG - Intergenic
1179151032 21:38808268-38808290 GAGTGGATGGTCCCCCAGCACGG + Intronic
1183453947 22:37911383-37911405 GAGTGTGTGACACACCTGCAGGG + Intronic
1183593300 22:38794140-38794162 GAGTGTCTTAGCAACCAGCAAGG + Exonic
1183671978 22:39278324-39278346 GAGTGTCTCCTCCACCAGAAGGG - Intergenic
956171908 3:66439668-66439690 GAGAGTTTTTTCCACCATCATGG + Intronic
960349675 3:116576845-116576867 GAATGTCTTATCCACCATCATGG + Intronic
962198905 3:133385447-133385469 TAGTGTCTGACCCACCAGCCTGG - Intronic
963267943 3:143257817-143257839 GAATGTCTTATCCACCATCATGG - Intergenic
963406353 3:144868496-144868518 GAGTATTTGAGCCCCCAGCATGG - Intergenic
964667871 3:159193570-159193592 GAATCTTTGATCCACCAACATGG - Intronic
969137893 4:5045173-5045195 GAGTCTTTGAGCCACCTGCCAGG + Intergenic
973118586 4:46490190-46490212 GAATGTCTTATCCACCATCACGG + Intergenic
974237263 4:59198272-59198294 CAGTGTTTGATGCCTCAGCATGG - Intergenic
975564052 4:75735045-75735067 GATTCTTTGATCCATGAGCATGG + Intronic
978400606 4:108326417-108326439 AAGTGTTTGGTCCATCTGCATGG + Intergenic
979750575 4:124274292-124274314 GGGTGTTTGAACCCACAGCAAGG - Intergenic
979767169 4:124475741-124475763 GAATGCTTTATCCACCATCATGG + Intergenic
979904122 4:126262977-126262999 AAGTGTTTGATACATCAGGAGGG + Intergenic
980743990 4:136991623-136991645 GAGTGTTTGATCCACTAATATGG - Intergenic
982783026 4:159510935-159510957 CAATGTTTGATCTACCAACATGG + Intergenic
985549497 5:525753-525775 GAATGTCTGCTCCACGAGCAAGG + Intergenic
987885606 5:23807646-23807668 GAATGCTTTATCCACCATCATGG + Intergenic
991248270 5:64531014-64531036 GAGTGTTTGACCCAAGAGGAAGG - Intronic
993034344 5:82740578-82740600 GAGTGTTTGATGCACTAACATGG + Intergenic
994379417 5:99053714-99053736 GAGTGTCTTTTCAACCAGCAAGG - Intergenic
995269402 5:110204338-110204360 GAATGCTTTATCCACCATCAGGG - Intergenic
996226801 5:121009087-121009109 CTATGTTTGGTCCACCAGCATGG + Intergenic
997753669 5:136374267-136374289 GAGTATTTGATTCACTGGCATGG + Intronic
999082588 5:148858299-148858321 GAGTCTCTGATTCACTAGCAAGG - Intergenic
999865265 5:155694282-155694304 GAGTGTTTGGTCTACCAGCAGGG - Intergenic
1000819800 5:165969278-165969300 GAGTCTTTTATCCATGAGCATGG + Intergenic
1003320260 6:5044761-5044783 TAGTGTTTCTTCCACCAGGATGG - Intergenic
1008677386 6:53834529-53834551 TACTGTGTGATCCTCCAGCATGG + Intronic
1010122969 6:72400620-72400642 GAGTGTGGGATCCACCAGTGAGG - Exonic
1014255121 6:119153446-119153468 GAGTCTATGATCAACAAGCAGGG - Intergenic
1016290971 6:142527741-142527763 GAGTTAGTGATCCACCAACATGG - Intergenic
1016472419 6:144388721-144388743 GACTGCTTGAGCCACCAGCCTGG - Intronic
1018600044 6:165528646-165528668 GAATGCTTTATCCACCATCATGG + Intronic
1018902736 6:168059469-168059491 GAGTGTCTGGTCCACCAGGAAGG - Intronic
1019878910 7:3841294-3841316 CATTGTTTGATCCAGCAGAACGG + Intronic
1022079051 7:27001478-27001500 GAATGTTTTATCCACCATCATGG + Intergenic
1023661190 7:42472653-42472675 GAGTATTTTATCCACGATCATGG + Intergenic
1024125186 7:46287491-46287513 TAGTGTTTGATAGATCAGCAAGG - Intergenic
1026233378 7:68505074-68505096 GAGTGTCTGAGCTCCCAGCAGGG - Intergenic
1029788522 7:102818126-102818148 GAATGTTGGAGCCACCACCAAGG + Intronic
1031327593 7:120421544-120421566 GAGAGTGTGATCCAACAGCACGG - Intronic
1032187898 7:129743285-129743307 GACTGTCTGGTCCAACAGCAGGG - Intronic
1033420768 7:141202898-141202920 GGGTGTGGGAACCACCAGCATGG + Intronic
1033808046 7:144976864-144976886 GAATGTTTGATCCACAAGTGTGG + Intergenic
1036094611 8:5710165-5710187 CAGTGTTGCATCCACCAACATGG + Intergenic
1037677806 8:21066905-21066927 CAGTGTTTAATCCAGCAACATGG + Intergenic
1039581599 8:38671277-38671299 GAGAGTATGAACCACCAACAAGG + Intergenic
1046163386 8:110396473-110396495 GAGTGTTTGATCCATTGACAAGG + Intergenic
1048622384 8:136148118-136148140 GAGTGTTCAATCCACTAGCATGG - Intergenic
1052589612 9:30474373-30474395 GAGTGTTTGCTCCACTGACATGG - Intergenic
1055053573 9:72003163-72003185 GAGTGTGAGATCAACCAGCCTGG - Intergenic
1055802917 9:80060225-80060247 CAGTGTCTCATCCTCCAGCAGGG + Intergenic
1056279656 9:85028855-85028877 GAGTGATGTAACCACCAGCAAGG - Intergenic
1059695161 9:116723712-116723734 GAGTATTTGATCTACCATCTAGG + Intronic
1186279670 X:7978262-7978284 GAATGCTTTATCCACCATCATGG + Intergenic
1189473829 X:41334188-41334210 GAGTGTTTGTTCCACCGCGAAGG - Exonic
1189563502 X:42215339-42215361 GAGGTTGTGAGCCACCAGCATGG - Intergenic
1192105478 X:68311726-68311748 CAGTGTTTGCTTCACCAGCTAGG - Intronic
1193053651 X:77126911-77126933 GAATGTCTTATCCACCATCATGG + Intergenic
1196397257 X:115277798-115277820 TAGTGTTTGATACATCAGTAGGG - Intergenic
1199009240 X:142739656-142739678 GAATGTTTGACCCAGCAGTATGG - Intergenic